ID: 1076489239

View in Genome Browser
Species Human (GRCh38)
Location 10:130845793-130845815
Sequence ACTCGGAGCCTCCCCGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076489239_1076489253 22 Left 1076489239 10:130845793-130845815 CCCCAGGCGGGGAGGCTCCGAGT No data
Right 1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG No data
1076489239_1076489244 0 Left 1076489239 10:130845793-130845815 CCCCAGGCGGGGAGGCTCCGAGT No data
Right 1076489244 10:130845816-130845838 CTCCCTTTAGACATCCCAGAGGG No data
1076489239_1076489243 -1 Left 1076489239 10:130845793-130845815 CCCCAGGCGGGGAGGCTCCGAGT No data
Right 1076489243 10:130845815-130845837 TCTCCCTTTAGACATCCCAGAGG No data
1076489239_1076489251 18 Left 1076489239 10:130845793-130845815 CCCCAGGCGGGGAGGCTCCGAGT No data
Right 1076489251 10:130845834-130845856 GAGGGAGGATGAACACAAGGAGG No data
1076489239_1076489252 19 Left 1076489239 10:130845793-130845815 CCCCAGGCGGGGAGGCTCCGAGT No data
Right 1076489252 10:130845835-130845857 AGGGAGGATGAACACAAGGAGGG No data
1076489239_1076489250 15 Left 1076489239 10:130845793-130845815 CCCCAGGCGGGGAGGCTCCGAGT No data
Right 1076489250 10:130845831-130845853 CCAGAGGGAGGATGAACACAAGG No data
1076489239_1076489254 23 Left 1076489239 10:130845793-130845815 CCCCAGGCGGGGAGGCTCCGAGT No data
Right 1076489254 10:130845839-130845861 AGGATGAACACAAGGAGGGTGGG No data
1076489239_1076489255 24 Left 1076489239 10:130845793-130845815 CCCCAGGCGGGGAGGCTCCGAGT No data
Right 1076489255 10:130845840-130845862 GGATGAACACAAGGAGGGTGGGG No data
1076489239_1076489247 3 Left 1076489239 10:130845793-130845815 CCCCAGGCGGGGAGGCTCCGAGT No data
Right 1076489247 10:130845819-130845841 CCTTTAGACATCCCAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076489239 Original CRISPR ACTCGGAGCCTCCCCGCCTG GGG (reversed) Intergenic
No off target data available for this crispr