ID: 1076489241

View in Genome Browser
Species Human (GRCh38)
Location 10:130845795-130845817
Sequence AGACTCGGAGCCTCCCCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076489241_1076489243 -3 Left 1076489241 10:130845795-130845817 CCAGGCGGGGAGGCTCCGAGTCT No data
Right 1076489243 10:130845815-130845837 TCTCCCTTTAGACATCCCAGAGG No data
1076489241_1076489255 22 Left 1076489241 10:130845795-130845817 CCAGGCGGGGAGGCTCCGAGTCT No data
Right 1076489255 10:130845840-130845862 GGATGAACACAAGGAGGGTGGGG No data
1076489241_1076489253 20 Left 1076489241 10:130845795-130845817 CCAGGCGGGGAGGCTCCGAGTCT No data
Right 1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG No data
1076489241_1076489254 21 Left 1076489241 10:130845795-130845817 CCAGGCGGGGAGGCTCCGAGTCT No data
Right 1076489254 10:130845839-130845861 AGGATGAACACAAGGAGGGTGGG No data
1076489241_1076489252 17 Left 1076489241 10:130845795-130845817 CCAGGCGGGGAGGCTCCGAGTCT No data
Right 1076489252 10:130845835-130845857 AGGGAGGATGAACACAAGGAGGG No data
1076489241_1076489247 1 Left 1076489241 10:130845795-130845817 CCAGGCGGGGAGGCTCCGAGTCT No data
Right 1076489247 10:130845819-130845841 CCTTTAGACATCCCAGAGGGAGG No data
1076489241_1076489250 13 Left 1076489241 10:130845795-130845817 CCAGGCGGGGAGGCTCCGAGTCT No data
Right 1076489250 10:130845831-130845853 CCAGAGGGAGGATGAACACAAGG No data
1076489241_1076489251 16 Left 1076489241 10:130845795-130845817 CCAGGCGGGGAGGCTCCGAGTCT No data
Right 1076489251 10:130845834-130845856 GAGGGAGGATGAACACAAGGAGG No data
1076489241_1076489244 -2 Left 1076489241 10:130845795-130845817 CCAGGCGGGGAGGCTCCGAGTCT No data
Right 1076489244 10:130845816-130845838 CTCCCTTTAGACATCCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076489241 Original CRISPR AGACTCGGAGCCTCCCCGCC TGG (reversed) Intergenic
No off target data available for this crispr