ID: 1076489245

View in Genome Browser
Species Human (GRCh38)
Location 10:130845818-130845840
Sequence CTCCCTCTGGGATGTCTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076489245_1076489256 29 Left 1076489245 10:130845818-130845840 CCCTTTAGACATCCCAGAGGGAG No data
Right 1076489256 10:130845870-130845892 TCTCCCTTTAGATACCCCAGAGG No data
1076489245_1076489252 -6 Left 1076489245 10:130845818-130845840 CCCTTTAGACATCCCAGAGGGAG No data
Right 1076489252 10:130845835-130845857 AGGGAGGATGAACACAAGGAGGG No data
1076489245_1076489255 -1 Left 1076489245 10:130845818-130845840 CCCTTTAGACATCCCAGAGGGAG No data
Right 1076489255 10:130845840-130845862 GGATGAACACAAGGAGGGTGGGG No data
1076489245_1076489257 30 Left 1076489245 10:130845818-130845840 CCCTTTAGACATCCCAGAGGGAG No data
Right 1076489257 10:130845871-130845893 CTCCCTTTAGATACCCCAGAGGG No data
1076489245_1076489254 -2 Left 1076489245 10:130845818-130845840 CCCTTTAGACATCCCAGAGGGAG No data
Right 1076489254 10:130845839-130845861 AGGATGAACACAAGGAGGGTGGG No data
1076489245_1076489250 -10 Left 1076489245 10:130845818-130845840 CCCTTTAGACATCCCAGAGGGAG No data
Right 1076489250 10:130845831-130845853 CCAGAGGGAGGATGAACACAAGG No data
1076489245_1076489253 -3 Left 1076489245 10:130845818-130845840 CCCTTTAGACATCCCAGAGGGAG No data
Right 1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG No data
1076489245_1076489251 -7 Left 1076489245 10:130845818-130845840 CCCTTTAGACATCCCAGAGGGAG No data
Right 1076489251 10:130845834-130845856 GAGGGAGGATGAACACAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076489245 Original CRISPR CTCCCTCTGGGATGTCTAAA GGG (reversed) Intergenic
No off target data available for this crispr