ID: 1076489253

View in Genome Browser
Species Human (GRCh38)
Location 10:130845838-130845860
Sequence GAGGATGAACACAAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076489245_1076489253 -3 Left 1076489245 10:130845818-130845840 CCCTTTAGACATCCCAGAGGGAG No data
Right 1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG No data
1076489241_1076489253 20 Left 1076489241 10:130845795-130845817 CCAGGCGGGGAGGCTCCGAGTCT No data
Right 1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG No data
1076489246_1076489253 -4 Left 1076489246 10:130845819-130845841 CCTTTAGACATCCCAGAGGGAGG No data
Right 1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG No data
1076489239_1076489253 22 Left 1076489239 10:130845793-130845815 CCCCAGGCGGGGAGGCTCCGAGT No data
Right 1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG No data
1076489242_1076489253 5 Left 1076489242 10:130845810-130845832 CCGAGTCTCCCTTTAGACATCCC No data
Right 1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG No data
1076489240_1076489253 21 Left 1076489240 10:130845794-130845816 CCCAGGCGGGGAGGCTCCGAGTC No data
Right 1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076489253 Original CRISPR GAGGATGAACACAAGGAGGG TGG Intergenic
No off target data available for this crispr