ID: 1076491548

View in Genome Browser
Species Human (GRCh38)
Location 10:130865109-130865131
Sequence TTCCCAGGGCTGCCCAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076491540_1076491548 28 Left 1076491540 10:130865058-130865080 CCCGCTTCTGGTGGAGATCGCTG No data
Right 1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG No data
1076491544_1076491548 -7 Left 1076491544 10:130865093-130865115 CCACTGATTGATGGCCTTCCCAG No data
Right 1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG No data
1076491541_1076491548 27 Left 1076491541 10:130865059-130865081 CCGCTTCTGGTGGAGATCGCTGT No data
Right 1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076491548 Original CRISPR TTCCCAGGGCTGCCCAAGAC AGG Intergenic
No off target data available for this crispr