ID: 1076493070

View in Genome Browser
Species Human (GRCh38)
Location 10:130876931-130876953
Sequence CCATTACCACAAGAACAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076493067_1076493070 11 Left 1076493067 10:130876897-130876919 CCCTTATAAAAGCATCAGATCTC 0: 46
1: 3730
2: 6109
3: 5397
4: 3492
Right 1076493070 10:130876931-130876953 CCATTACCACAAGAACAGCATGG No data
1076493068_1076493070 10 Left 1076493068 10:130876898-130876920 CCTTATAAAAGCATCAGATCTCG 0: 11
1: 724
2: 4008
3: 4657
4: 3806
Right 1076493070 10:130876931-130876953 CCATTACCACAAGAACAGCATGG No data
1076493065_1076493070 29 Left 1076493065 10:130876879-130876901 CCAAGCAAAAGGGGTTTCCCCTT 0: 137
1: 230
2: 425
3: 605
4: 759
Right 1076493070 10:130876931-130876953 CCATTACCACAAGAACAGCATGG No data
1076493066_1076493070 12 Left 1076493066 10:130876896-130876918 CCCCTTATAAAAGCATCAGATCT 0: 36
1: 3224
2: 7040
3: 7171
4: 4321
Right 1076493070 10:130876931-130876953 CCATTACCACAAGAACAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076493070 Original CRISPR CCATTACCACAAGAACAGCA TGG Intergenic
No off target data available for this crispr