ID: 1076493115

View in Genome Browser
Species Human (GRCh38)
Location 10:130877228-130877250
Sequence CGGTTCACACAAATGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076493109_1076493115 6 Left 1076493109 10:130877199-130877221 CCATTCCTGCTATATTTCTTCTG No data
Right 1076493115 10:130877228-130877250 CGGTTCACACAAATGGCTCATGG No data
1076493111_1076493115 1 Left 1076493111 10:130877204-130877226 CCTGCTATATTTCTTCTGGTACC No data
Right 1076493115 10:130877228-130877250 CGGTTCACACAAATGGCTCATGG No data
1076493108_1076493115 7 Left 1076493108 10:130877198-130877220 CCCATTCCTGCTATATTTCTTCT No data
Right 1076493115 10:130877228-130877250 CGGTTCACACAAATGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076493115 Original CRISPR CGGTTCACACAAATGGCTCA TGG Intergenic
No off target data available for this crispr