ID: 1076493548

View in Genome Browser
Species Human (GRCh38)
Location 10:130880898-130880920
Sequence ATGTGTTTACCGAGGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076493548_1076493551 10 Left 1076493548 10:130880898-130880920 CCAATTTCCCTCGGTAAACACAT No data
Right 1076493551 10:130880931-130880953 GATAAGCTTCTCTTTCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076493548 Original CRISPR ATGTGTTTACCGAGGGAAAT TGG (reversed) Intergenic
No off target data available for this crispr