ID: 1076494171

View in Genome Browser
Species Human (GRCh38)
Location 10:130885973-130885995
Sequence CCTGCCGTGCCTGTTTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076494169_1076494171 0 Left 1076494169 10:130885950-130885972 CCTCAGGACTCAGGAGGCTTCTT No data
Right 1076494171 10:130885973-130885995 CCTGCCGTGCCTGTTTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076494171 Original CRISPR CCTGCCGTGCCTGTTTTCTT TGG Intergenic
No off target data available for this crispr