ID: 1076495246

View in Genome Browser
Species Human (GRCh38)
Location 10:130892996-130893018
Sequence AGATTGCCACAGCTGGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076495240_1076495246 16 Left 1076495240 10:130892957-130892979 CCATGCTCAGAATTGCACATCAG No data
Right 1076495246 10:130892996-130893018 AGATTGCCACAGCTGGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076495246 Original CRISPR AGATTGCCACAGCTGGACCA AGG Intergenic
No off target data available for this crispr