ID: 1076495870

View in Genome Browser
Species Human (GRCh38)
Location 10:130897594-130897616
Sequence CAGGTGGAACAGAGAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076495870_1076495873 30 Left 1076495870 10:130897594-130897616 CCTTCAGCTCTCTGTTCCACCTG No data
Right 1076495873 10:130897647-130897669 TGTGTGAAGAAAATTGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076495870 Original CRISPR CAGGTGGAACAGAGAGCTGA AGG (reversed) Intergenic
No off target data available for this crispr