ID: 1076496899

View in Genome Browser
Species Human (GRCh38)
Location 10:130903530-130903552
Sequence GCCAGGAAGCTGCTGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076496899_1076496902 0 Left 1076496899 10:130903530-130903552 CCTGGGACCAGCAGCTTCCTGGC No data
Right 1076496902 10:130903553-130903575 TGTTTCTCTCCATTCAGATCTGG No data
1076496899_1076496904 26 Left 1076496899 10:130903530-130903552 CCTGGGACCAGCAGCTTCCTGGC No data
Right 1076496904 10:130903579-130903601 TGCTATACCCCCAGTGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076496899 Original CRISPR GCCAGGAAGCTGCTGGTCCC AGG (reversed) Intergenic
No off target data available for this crispr