ID: 1076501836

View in Genome Browser
Species Human (GRCh38)
Location 10:130943331-130943353
Sequence AAGAACAGCTGGAAGACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076501832_1076501836 18 Left 1076501832 10:130943290-130943312 CCTCACCCAGATTACGATTTGGA No data
Right 1076501836 10:130943331-130943353 AAGAACAGCTGGAAGACTACTGG No data
1076501834_1076501836 12 Left 1076501834 10:130943296-130943318 CCAGATTACGATTTGGATTAAAT No data
Right 1076501836 10:130943331-130943353 AAGAACAGCTGGAAGACTACTGG No data
1076501830_1076501836 19 Left 1076501830 10:130943289-130943311 CCCTCACCCAGATTACGATTTGG No data
Right 1076501836 10:130943331-130943353 AAGAACAGCTGGAAGACTACTGG No data
1076501833_1076501836 13 Left 1076501833 10:130943295-130943317 CCCAGATTACGATTTGGATTAAA No data
Right 1076501836 10:130943331-130943353 AAGAACAGCTGGAAGACTACTGG No data
1076501829_1076501836 26 Left 1076501829 10:130943282-130943304 CCTCAGACCCTCACCCAGATTAC No data
Right 1076501836 10:130943331-130943353 AAGAACAGCTGGAAGACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076501836 Original CRISPR AAGAACAGCTGGAAGACTAC TGG Intergenic
No off target data available for this crispr