ID: 1076504142

View in Genome Browser
Species Human (GRCh38)
Location 10:130960786-130960808
Sequence GGCTGGGTATTGGGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076504132_1076504142 2 Left 1076504132 10:130960761-130960783 CCTCGGGTTCTGTCCCAGAGGCT No data
Right 1076504142 10:130960786-130960808 GGCTGGGTATTGGGGGCAGATGG No data
1076504128_1076504142 20 Left 1076504128 10:130960743-130960765 CCTGTTCTTGCACTGTGTCCTCG No data
Right 1076504142 10:130960786-130960808 GGCTGGGTATTGGGGGCAGATGG No data
1076504127_1076504142 26 Left 1076504127 10:130960737-130960759 CCAAGACCTGTTCTTGCACTGTG No data
Right 1076504142 10:130960786-130960808 GGCTGGGTATTGGGGGCAGATGG No data
1076504126_1076504142 29 Left 1076504126 10:130960734-130960756 CCTCCAAGACCTGTTCTTGCACT No data
Right 1076504142 10:130960786-130960808 GGCTGGGTATTGGGGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076504142 Original CRISPR GGCTGGGTATTGGGGGCAGA TGG Intergenic
No off target data available for this crispr