ID: 1076506871

View in Genome Browser
Species Human (GRCh38)
Location 10:130984162-130984184
Sequence CAAGCTCACCAGCACACCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076506871_1076506874 26 Left 1076506871 10:130984162-130984184 CCCATGGTGTGCTGGTGAGCTTG No data
Right 1076506874 10:130984211-130984233 AGTCTGGATTGCAGCCAATGAGG No data
1076506871_1076506873 10 Left 1076506871 10:130984162-130984184 CCCATGGTGTGCTGGTGAGCTTG No data
Right 1076506873 10:130984195-130984217 TGTCAAAGACAAAATGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076506871 Original CRISPR CAAGCTCACCAGCACACCAT GGG (reversed) Intergenic
No off target data available for this crispr