ID: 1076509216

View in Genome Browser
Species Human (GRCh38)
Location 10:131000127-131000149
Sequence CCTCAAAGAGAGACAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076509216_1076509221 -1 Left 1076509216 10:131000127-131000149 CCTTCCATTGTCTCTCTTTGAGG No data
Right 1076509221 10:131000149-131000171 GGTCCTTACTCTTGCCCTGTGGG No data
1076509216_1076509220 -2 Left 1076509216 10:131000127-131000149 CCTTCCATTGTCTCTCTTTGAGG No data
Right 1076509220 10:131000148-131000170 GGGTCCTTACTCTTGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076509216 Original CRISPR CCTCAAAGAGAGACAATGGA AGG (reversed) Intergenic
No off target data available for this crispr