ID: 1076510953

View in Genome Browser
Species Human (GRCh38)
Location 10:131013204-131013226
Sequence GAGAGTGAAAAATGTGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076510953_1076510960 10 Left 1076510953 10:131013204-131013226 CCCTGCACACATTTTTCACTCTC No data
Right 1076510960 10:131013237-131013259 CTGGGCCTCATTTATTTCCCAGG No data
1076510953_1076510959 -8 Left 1076510953 10:131013204-131013226 CCCTGCACACATTTTTCACTCTC No data
Right 1076510959 10:131013219-131013241 TCACTCTCATTCTGGGGACTGGG No data
1076510953_1076510961 14 Left 1076510953 10:131013204-131013226 CCCTGCACACATTTTTCACTCTC No data
Right 1076510961 10:131013241-131013263 GCCTCATTTATTTCCCAGGCTGG No data
1076510953_1076510963 15 Left 1076510953 10:131013204-131013226 CCCTGCACACATTTTTCACTCTC No data
Right 1076510963 10:131013242-131013264 CCTCATTTATTTCCCAGGCTGGG No data
1076510953_1076510958 -9 Left 1076510953 10:131013204-131013226 CCCTGCACACATTTTTCACTCTC No data
Right 1076510958 10:131013218-131013240 TTCACTCTCATTCTGGGGACTGG No data
1076510953_1076510965 27 Left 1076510953 10:131013204-131013226 CCCTGCACACATTTTTCACTCTC No data
Right 1076510965 10:131013254-131013276 CCCAGGCTGGGTTCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076510953 Original CRISPR GAGAGTGAAAAATGTGTGCA GGG (reversed) Intergenic
No off target data available for this crispr