ID: 1076513037

View in Genome Browser
Species Human (GRCh38)
Location 10:131025685-131025707
Sequence CCCTCAAAGCAGAGAGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076513031_1076513037 1 Left 1076513031 10:131025661-131025683 CCTGGAGGGAAGAAAGCATGAGG No data
Right 1076513037 10:131025685-131025707 CCCTCAAAGCAGAGAGGGCACGG No data
1076513028_1076513037 13 Left 1076513028 10:131025649-131025671 CCAGGTCCACGCCCTGGAGGGAA No data
Right 1076513037 10:131025685-131025707 CCCTCAAAGCAGAGAGGGCACGG No data
1076513030_1076513037 2 Left 1076513030 10:131025660-131025682 CCCTGGAGGGAAGAAAGCATGAG No data
Right 1076513037 10:131025685-131025707 CCCTCAAAGCAGAGAGGGCACGG No data
1076513029_1076513037 7 Left 1076513029 10:131025655-131025677 CCACGCCCTGGAGGGAAGAAAGC No data
Right 1076513037 10:131025685-131025707 CCCTCAAAGCAGAGAGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076513037 Original CRISPR CCCTCAAAGCAGAGAGGGCA CGG Intergenic
No off target data available for this crispr