ID: 1076513138

View in Genome Browser
Species Human (GRCh38)
Location 10:131026307-131026329
Sequence TTATTTATGTTTTAATAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076513138_1076513144 18 Left 1076513138 10:131026307-131026329 CCATTTTATTAAAACATAAATAA No data
Right 1076513144 10:131026348-131026370 TGGCCAAGAACAACGAAGTCAGG No data
1076513138_1076513146 22 Left 1076513138 10:131026307-131026329 CCATTTTATTAAAACATAAATAA No data
Right 1076513146 10:131026352-131026374 CAAGAACAACGAAGTCAGGCAGG No data
1076513138_1076513148 29 Left 1076513138 10:131026307-131026329 CCATTTTATTAAAACATAAATAA No data
Right 1076513148 10:131026359-131026381 AACGAAGTCAGGCAGGCTTTGGG No data
1076513138_1076513149 30 Left 1076513138 10:131026307-131026329 CCATTTTATTAAAACATAAATAA No data
Right 1076513149 10:131026360-131026382 ACGAAGTCAGGCAGGCTTTGGGG No data
1076513138_1076513147 28 Left 1076513138 10:131026307-131026329 CCATTTTATTAAAACATAAATAA No data
Right 1076513147 10:131026358-131026380 CAACGAAGTCAGGCAGGCTTTGG No data
1076513138_1076513141 -2 Left 1076513138 10:131026307-131026329 CCATTTTATTAAAACATAAATAA No data
Right 1076513141 10:131026328-131026350 AAGTGTCCTGGGACTTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076513138 Original CRISPR TTATTTATGTTTTAATAAAA TGG (reversed) Intergenic
No off target data available for this crispr