ID: 1076513141

View in Genome Browser
Species Human (GRCh38)
Location 10:131026328-131026350
Sequence AAGTGTCCTGGGACTTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076513137_1076513141 21 Left 1076513137 10:131026284-131026306 CCAGTGGAAAAATAGATTTGAAT No data
Right 1076513141 10:131026328-131026350 AAGTGTCCTGGGACTTGCCATGG No data
1076513138_1076513141 -2 Left 1076513138 10:131026307-131026329 CCATTTTATTAAAACATAAATAA No data
Right 1076513141 10:131026328-131026350 AAGTGTCCTGGGACTTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076513141 Original CRISPR AAGTGTCCTGGGACTTGCCA TGG Intergenic
No off target data available for this crispr