ID: 1076513143

View in Genome Browser
Species Human (GRCh38)
Location 10:131026345-131026367
Sequence GACTTCGTTGTTCTTGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076513143_1076513148 -9 Left 1076513143 10:131026345-131026367 CCATGGCCAAGAACAACGAAGTC No data
Right 1076513148 10:131026359-131026381 AACGAAGTCAGGCAGGCTTTGGG No data
1076513143_1076513150 19 Left 1076513143 10:131026345-131026367 CCATGGCCAAGAACAACGAAGTC No data
Right 1076513150 10:131026387-131026409 GAGCCTCCGACACAAAACAGAGG No data
1076513143_1076513149 -8 Left 1076513143 10:131026345-131026367 CCATGGCCAAGAACAACGAAGTC No data
Right 1076513149 10:131026360-131026382 ACGAAGTCAGGCAGGCTTTGGGG No data
1076513143_1076513153 27 Left 1076513143 10:131026345-131026367 CCATGGCCAAGAACAACGAAGTC No data
Right 1076513153 10:131026395-131026417 GACACAAAACAGAGGAAAAATGG No data
1076513143_1076513154 28 Left 1076513143 10:131026345-131026367 CCATGGCCAAGAACAACGAAGTC No data
Right 1076513154 10:131026396-131026418 ACACAAAACAGAGGAAAAATGGG No data
1076513143_1076513147 -10 Left 1076513143 10:131026345-131026367 CCATGGCCAAGAACAACGAAGTC No data
Right 1076513147 10:131026358-131026380 CAACGAAGTCAGGCAGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076513143 Original CRISPR GACTTCGTTGTTCTTGGCCA TGG (reversed) Intergenic
No off target data available for this crispr