ID: 1076513148

View in Genome Browser
Species Human (GRCh38)
Location 10:131026359-131026381
Sequence AACGAAGTCAGGCAGGCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076513138_1076513148 29 Left 1076513138 10:131026307-131026329 CCATTTTATTAAAACATAAATAA No data
Right 1076513148 10:131026359-131026381 AACGAAGTCAGGCAGGCTTTGGG No data
1076513142_1076513148 2 Left 1076513142 10:131026334-131026356 CCTGGGACTTGCCATGGCCAAGA No data
Right 1076513148 10:131026359-131026381 AACGAAGTCAGGCAGGCTTTGGG No data
1076513143_1076513148 -9 Left 1076513143 10:131026345-131026367 CCATGGCCAAGAACAACGAAGTC No data
Right 1076513148 10:131026359-131026381 AACGAAGTCAGGCAGGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076513148 Original CRISPR AACGAAGTCAGGCAGGCTTT GGG Intergenic
No off target data available for this crispr