ID: 1076513913

View in Genome Browser
Species Human (GRCh38)
Location 10:131032605-131032627
Sequence GGCGGCCCTGTGAATTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076513913_1076513918 1 Left 1076513913 10:131032605-131032627 CCCACTGAATTCACAGGGCCGCC No data
Right 1076513918 10:131032629-131032651 GAACCACCATGCCAGCGTCATGG No data
1076513913_1076513919 2 Left 1076513913 10:131032605-131032627 CCCACTGAATTCACAGGGCCGCC No data
Right 1076513919 10:131032630-131032652 AACCACCATGCCAGCGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076513913 Original CRISPR GGCGGCCCTGTGAATTCAGT GGG (reversed) Intergenic
No off target data available for this crispr