ID: 1076515748

View in Genome Browser
Species Human (GRCh38)
Location 10:131043538-131043560
Sequence CCGTGTCTTTGTCAGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076515743_1076515748 2 Left 1076515743 10:131043513-131043535 CCTGAGGGCTCTGAGCCTCTTGG No data
Right 1076515748 10:131043538-131043560 CCGTGTCTTTGTCAGGCTGCAGG No data
1076515742_1076515748 3 Left 1076515742 10:131043512-131043534 CCCTGAGGGCTCTGAGCCTCTTG No data
Right 1076515748 10:131043538-131043560 CCGTGTCTTTGTCAGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076515748 Original CRISPR CCGTGTCTTTGTCAGGCTGC AGG Intergenic
No off target data available for this crispr