ID: 1076516084

View in Genome Browser
Species Human (GRCh38)
Location 10:131045158-131045180
Sequence GTTGCAGTAAAGGCCTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076516084_1076516097 30 Left 1076516084 10:131045158-131045180 CCAGGAAAGGCCTTTACTGCAAC No data
Right 1076516097 10:131045211-131045233 TGCCCCTCTCCTGGTGGTTGAGG No data
1076516084_1076516087 -4 Left 1076516084 10:131045158-131045180 CCAGGAAAGGCCTTTACTGCAAC No data
Right 1076516087 10:131045177-131045199 CAACCCTCAGCCCCCATGATGGG No data
1076516084_1076516089 -1 Left 1076516084 10:131045158-131045180 CCAGGAAAGGCCTTTACTGCAAC No data
Right 1076516089 10:131045180-131045202 CCCTCAGCCCCCATGATGGGTGG No data
1076516084_1076516086 -5 Left 1076516084 10:131045158-131045180 CCAGGAAAGGCCTTTACTGCAAC No data
Right 1076516086 10:131045176-131045198 GCAACCCTCAGCCCCCATGATGG No data
1076516084_1076516095 21 Left 1076516084 10:131045158-131045180 CCAGGAAAGGCCTTTACTGCAAC No data
Right 1076516095 10:131045202-131045224 GATATGATATGCCCCTCTCCTGG No data
1076516084_1076516096 24 Left 1076516084 10:131045158-131045180 CCAGGAAAGGCCTTTACTGCAAC No data
Right 1076516096 10:131045205-131045227 ATGATATGCCCCTCTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076516084 Original CRISPR GTTGCAGTAAAGGCCTTTCC TGG (reversed) Intergenic
No off target data available for this crispr