ID: 1076516086

View in Genome Browser
Species Human (GRCh38)
Location 10:131045176-131045198
Sequence GCAACCCTCAGCCCCCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076516084_1076516086 -5 Left 1076516084 10:131045158-131045180 CCAGGAAAGGCCTTTACTGCAAC No data
Right 1076516086 10:131045176-131045198 GCAACCCTCAGCCCCCATGATGG No data
1076516081_1076516086 15 Left 1076516081 10:131045138-131045160 CCACATCAAGAAACGAGATTCCA No data
Right 1076516086 10:131045176-131045198 GCAACCCTCAGCCCCCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076516086 Original CRISPR GCAACCCTCAGCCCCCATGA TGG Intergenic
No off target data available for this crispr