ID: 1076517523

View in Genome Browser
Species Human (GRCh38)
Location 10:131056466-131056488
Sequence GCGTCTCAGTCACGCCAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076517523_1076517525 -8 Left 1076517523 10:131056466-131056488 CCACGCTGGCGTGACTGAGACGC No data
Right 1076517525 10:131056481-131056503 TGAGACGCCCTCTGTGGAAGAGG No data
1076517523_1076517529 18 Left 1076517523 10:131056466-131056488 CCACGCTGGCGTGACTGAGACGC No data
Right 1076517529 10:131056507-131056529 ATCCTGCCCCAGAAAGTCCAGGG No data
1076517523_1076517528 17 Left 1076517523 10:131056466-131056488 CCACGCTGGCGTGACTGAGACGC No data
Right 1076517528 10:131056506-131056528 CATCCTGCCCCAGAAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076517523 Original CRISPR GCGTCTCAGTCACGCCAGCG TGG (reversed) Intergenic
No off target data available for this crispr