ID: 1076517525

View in Genome Browser
Species Human (GRCh38)
Location 10:131056481-131056503
Sequence TGAGACGCCCTCTGTGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076517522_1076517525 -3 Left 1076517522 10:131056461-131056483 CCATTCCACGCTGGCGTGACTGA No data
Right 1076517525 10:131056481-131056503 TGAGACGCCCTCTGTGGAAGAGG No data
1076517523_1076517525 -8 Left 1076517523 10:131056466-131056488 CCACGCTGGCGTGACTGAGACGC No data
Right 1076517525 10:131056481-131056503 TGAGACGCCCTCTGTGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076517525 Original CRISPR TGAGACGCCCTCTGTGGAAG AGG Intergenic
No off target data available for this crispr