ID: 1076517781

View in Genome Browser
Species Human (GRCh38)
Location 10:131058511-131058533
Sequence GCCATAAGGCCCTAAGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076517777_1076517781 23 Left 1076517777 10:131058465-131058487 CCCATCTCTACTAAAAATACAAA No data
Right 1076517781 10:131058511-131058533 GCCATAAGGCCCTAAGGAAATGG No data
1076517778_1076517781 22 Left 1076517778 10:131058466-131058488 CCATCTCTACTAAAAATACAAAA No data
Right 1076517781 10:131058511-131058533 GCCATAAGGCCCTAAGGAAATGG No data
1076517776_1076517781 24 Left 1076517776 10:131058464-131058486 CCCCATCTCTACTAAAAATACAA No data
Right 1076517781 10:131058511-131058533 GCCATAAGGCCCTAAGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076517781 Original CRISPR GCCATAAGGCCCTAAGGAAA TGG Intergenic