ID: 1076519709

View in Genome Browser
Species Human (GRCh38)
Location 10:131073867-131073889
Sequence GCACACACGCTCCCAAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076519709_1076519714 8 Left 1076519709 10:131073867-131073889 CCTTTCCTTGGGAGCGTGTGTGC No data
Right 1076519714 10:131073898-131073920 AGCCCTGGTGGCCCCAAAGCTGG No data
1076519709_1076519712 -4 Left 1076519709 10:131073867-131073889 CCTTTCCTTGGGAGCGTGTGTGC No data
Right 1076519712 10:131073886-131073908 GTGCTGCCTCACAGCCCTGGTGG No data
1076519709_1076519711 -7 Left 1076519709 10:131073867-131073889 CCTTTCCTTGGGAGCGTGTGTGC No data
Right 1076519711 10:131073883-131073905 TGTGTGCTGCCTCACAGCCCTGG No data
1076519709_1076519717 14 Left 1076519709 10:131073867-131073889 CCTTTCCTTGGGAGCGTGTGTGC No data
Right 1076519717 10:131073904-131073926 GGTGGCCCCAAAGCTGGAACTGG No data
1076519709_1076519721 27 Left 1076519709 10:131073867-131073889 CCTTTCCTTGGGAGCGTGTGTGC No data
Right 1076519721 10:131073917-131073939 CTGGAACTGGACTCTGATTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076519709 Original CRISPR GCACACACGCTCCCAAGGAA AGG (reversed) Intergenic
No off target data available for this crispr