ID: 1076521668

View in Genome Browser
Species Human (GRCh38)
Location 10:131085111-131085133
Sequence CTGTGTCCCCACAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076521668_1076521679 6 Left 1076521668 10:131085111-131085133 CCCTCTGCCCTGTGGGGACACAG No data
Right 1076521679 10:131085140-131085162 GGGCCCCGTCTTTGAGGAAGGGG No data
1076521668_1076521676 0 Left 1076521668 10:131085111-131085133 CCCTCTGCCCTGTGGGGACACAG No data
Right 1076521676 10:131085134-131085156 CCAGGAGGGCCCCGTCTTTGAGG No data
1076521668_1076521678 5 Left 1076521668 10:131085111-131085133 CCCTCTGCCCTGTGGGGACACAG No data
Right 1076521678 10:131085139-131085161 AGGGCCCCGTCTTTGAGGAAGGG No data
1076521668_1076521677 4 Left 1076521668 10:131085111-131085133 CCCTCTGCCCTGTGGGGACACAG No data
Right 1076521677 10:131085138-131085160 GAGGGCCCCGTCTTTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076521668 Original CRISPR CTGTGTCCCCACAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr