ID: 1076523282

View in Genome Browser
Species Human (GRCh38)
Location 10:131094346-131094368
Sequence CTCTGTAAGGAGAAGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 1, 2: 6, 3: 39, 4: 332}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076523282_1076523287 3 Left 1076523282 10:131094346-131094368 CCCTCCCACTTCTCCTTACAGAG 0: 1
1: 1
2: 6
3: 39
4: 332
Right 1076523287 10:131094372-131094394 TTTACACTTCCTTGCAGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076523282 Original CRISPR CTCTGTAAGGAGAAGTGGGA GGG (reversed) Intronic
900245670 1:1634991-1635013 TTCTGCAAGGAGATGTGGGTGGG + Intronic
900256900 1:1702148-1702170 TTCTGCAAGGAGATGTGGGTGGG + Intronic
902533874 1:17107761-17107783 CTCTGGCAGGAGAATTGGGAAGG + Intronic
902664145 1:17925849-17925871 CTCTGTGGGGAGAAGACGGAGGG - Intergenic
902744358 1:18463562-18463584 CTCGGTAATGAGATGTGAGAGGG - Intergenic
903541025 1:24096425-24096447 ATCTGGAAGGAGTGGTGGGAAGG + Intronic
903563465 1:24246466-24246488 CCCTGAAAGGAGGAGAGGGAAGG - Intergenic
903691733 1:25178904-25178926 CTATGCAGGCAGAAGTGGGAGGG - Intergenic
904305563 1:29586418-29586440 CTCTGTCAGTAGAAGCTGGAAGG + Intergenic
905264499 1:36741993-36742015 TGCTGTTAGTAGAAGTGGGATGG - Intergenic
905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG + Intergenic
905536533 1:38726651-38726673 CTCTGGAAGCAGAAATGGGTAGG + Intergenic
906065684 1:42978663-42978685 CTGTGTAAGATGAGGTGGGAAGG - Intergenic
906301756 1:44687513-44687535 CTCTGTGAGGAGAAACTGGAGGG + Intronic
906348515 1:45036904-45036926 CTCAGGAAGCTGAAGTGGGAGGG - Intronic
907039568 1:51246329-51246351 CTTTGGAAGGCCAAGTGGGAAGG + Intronic
907922743 1:58928740-58928762 CTCTGAAAAGATAAGAGGGAGGG - Intergenic
908189239 1:61684378-61684400 CACAGTGAGGAGAAGTGGGAAGG - Intronic
909945955 1:81663092-81663114 CACTGTAAGGAGCACAGGGAGGG + Intronic
910975185 1:92898868-92898890 CTCGGGAAGGTGAAGTGGGAGGG - Intronic
913969253 1:143402110-143402132 CCCTTCAAGAAGAAGTGGGAAGG + Intergenic
914063630 1:144227709-144227731 CCCTTCAAGAAGAAGTGGGAAGG + Intergenic
914115520 1:144738645-144738667 CCCTTCAAGAAGAAGTGGGAAGG - Intergenic
914365572 1:146975159-146975181 CTCACTAAGGGTAAGTGGGATGG - Intronic
915493858 1:156267245-156267267 GGCAGTAAGGAGAAGGGGGAAGG + Intronic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
915938477 1:160103066-160103088 CTGGGAATGGAGAAGTGGGATGG - Intergenic
916926021 1:169521477-169521499 CTCTGTCAGGAAAAGGGGTAGGG - Intronic
920039005 1:203084030-203084052 ATCTGTAAGGGGAGGTGGGAAGG + Exonic
920231478 1:204473367-204473389 ATCTGTAAGGAGCTGTGGAAAGG - Intronic
920335971 1:205245350-205245372 CTCTGGAAGGTCCAGTGGGAGGG + Intronic
920386602 1:205574335-205574357 CTCAGGAGGCAGAAGTGGGAGGG + Intronic
920530620 1:206699442-206699464 GTTTCTAAGGAGAAGTGTGAGGG + Intronic
920769972 1:208874879-208874901 CTATGTAAGGAGTGCTGGGAAGG - Intergenic
921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG + Intergenic
921625892 1:217377432-217377454 GTGTGTAAAGAGAAGTGGCATGG + Intergenic
921686790 1:218098499-218098521 CACGGTAAGCAGAAGTCGGAGGG - Intergenic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
922114695 1:222601418-222601440 CTCAGTAAGAATAAGTGGGTGGG - Intergenic
922145753 1:222942543-222942565 CACTGAAAGGAGAGGTGGGCAGG + Intronic
923438496 1:233992887-233992909 GTCTGAAAGGGAAAGTGGGAGGG + Intronic
923915641 1:238500793-238500815 TTCTGTATGGAGGAGTGGGCTGG + Intergenic
924230054 1:241955529-241955551 CCCTGTAGGGAGAAGTGTCAGGG + Intergenic
924587864 1:245375746-245375768 CTTGGTAAGGAGAAGCGGGATGG + Intronic
1063828463 10:9925289-9925311 CTCAGGAAGCTGAAGTGGGAGGG - Intergenic
1064324729 10:14339545-14339567 TTCTGTAAGGAGAATTCTGAAGG + Intronic
1065343511 10:24726624-24726646 ATCTGTACGGAGAAGTGCAAAGG + Intergenic
1065806128 10:29395004-29395026 CTCAGAAAGGAGAAAGGGGATGG - Intergenic
1068177129 10:53475811-53475833 ATCTGAAAGGAGAAGGGTGAGGG - Intergenic
1068485696 10:57655572-57655594 GTCTGGAAGGTGAAATGGGAAGG + Intergenic
1068629504 10:59284909-59284931 CTATGTGAGGAGAGGTGTGAAGG - Intronic
1068638464 10:59374492-59374514 GTCTGTAAGTAGAAGTGGAGGGG + Intergenic
1069351375 10:67531117-67531139 CTCTGTTAGGAAGAGTGGAAGGG + Intronic
1070734588 10:78854807-78854829 CTCTTTGAGGAGGAGTGGGGAGG - Intergenic
1072982936 10:100114962-100114984 CTCTTTAAGGAGGAGTTGGACGG - Intergenic
1073203832 10:101758026-101758048 CTCTGTAGAGAGAAGTGGAATGG + Intergenic
1074183383 10:111082037-111082059 CTGTGTATGCAGCAGTGGGAGGG + Intergenic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1077063011 11:625990-626012 TTCTGTAAGGGGTAGTGGGGAGG - Intronic
1077737861 11:4810137-4810159 CTCTGTATACAGAAGTAGGAAGG + Intronic
1078267546 11:9766287-9766309 CACTCCAAGGAGAGGTGGGATGG - Intergenic
1078921172 11:15832072-15832094 CCCAGTAAGGGGAGGTGGGAAGG + Intergenic
1080549265 11:33357043-33357065 CCCTGTAAGGAGTATTGGGGTGG - Intergenic
1081205001 11:40264792-40264814 GTCTGGAAGAAGATGTGGGAGGG - Intronic
1081532207 11:43969740-43969762 CTCTGTCAGGCTAAGTGGCAGGG - Intergenic
1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG + Exonic
1082896899 11:58201330-58201352 CTCTTGATGGAGAAGTGGTAGGG + Intergenic
1084560005 11:69899303-69899325 CTCTGTAACCAGAATGGGGAGGG - Intergenic
1084918418 11:72449259-72449281 ATCTGTGAGGAGAAGCGGGAGGG + Intergenic
1085602600 11:77868757-77868779 CTGTGTAAGAACCAGTGGGAAGG - Intronic
1088190060 11:107218688-107218710 ATCTGGAGGGAGAAGTGGGGAGG - Intergenic
1088498909 11:110462333-110462355 ATCTGTATGGAAAAGGGGGAAGG - Exonic
1090106168 11:123855168-123855190 CCCAGTAAGGAGAAGTGGGTCGG - Intergenic
1090379689 11:126317773-126317795 CTGTGTGTGGAGAAGTGGGGGGG + Intronic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091296408 11:134476972-134476994 CTTTGTGAAGAGAAGGGGGAGGG + Intergenic
1091592909 12:1855932-1855954 CTTTGCCAGGAGAGGTGGGAAGG - Intronic
1091736014 12:2922688-2922710 CTCTGTCAGAAGAAGAGGGTGGG - Intronic
1092112501 12:5973705-5973727 CTCAGGAAGAAGAAGAGGGAGGG - Intronic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095384267 12:41631693-41631715 CTGTGTAAGCTGAGGTGGGATGG + Intergenic
1095986172 12:48001275-48001297 CTCTTTAAAGAGCAGTGGGCAGG - Intronic
1098210053 12:68153955-68153977 CTATGTATGGTGGAGTGGGAGGG - Intergenic
1099255804 12:80309840-80309862 TTCAGGAAGGAGATGTGGGATGG + Intronic
1099284782 12:80704191-80704213 TTCTGTGGGAAGAAGTGGGAAGG - Intergenic
1101358823 12:104007294-104007316 ATCTGGAAAGAGAAGGGGGAGGG - Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1102439216 12:112948730-112948752 CTCAGAGAGGGGAAGTGGGAGGG - Intronic
1102454658 12:113064030-113064052 CTCTCAAGGGAGAAGGGGGAAGG - Intronic
1103669700 12:122603301-122603323 ATCTTTAAGGAGAAGCAGGATGG + Intronic
1103698806 12:122836723-122836745 CTCTGCAAGGACAAGTGGGACGG - Intronic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1105420586 13:20248410-20248432 CTCTGTAAGGAGCAGTGGGATGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1110804280 13:79736479-79736501 CCCAGTAAGGAGAAGTGGATTGG + Intergenic
1113405247 13:110032896-110032918 CTCTTTAAGGAGAAGCGGGTGGG - Intergenic
1113508814 13:110835183-110835205 CACCATAGGGAGAAGTGGGATGG - Intergenic
1114586935 14:23824216-23824238 CAGTGTAAGAGGAAGTGGGAGGG - Intergenic
1114656695 14:24319991-24320013 CTGTTTAAGAAGAATTGGGAAGG + Intronic
1116268691 14:42730628-42730650 CTCTGTCAGGAGAGATAGGAAGG + Intergenic
1116402217 14:44521733-44521755 TTCTGTATGGAGGAGAGGGAGGG + Intergenic
1118347446 14:64950458-64950480 CTCTGTAGGGAAAATTGGGGGGG - Intronic
1118769839 14:68935352-68935374 CTCTGACAGGAGAAGGGAGAGGG - Intronic
1121318601 14:92977256-92977278 CTCTGTAAGGTGATCTTGGATGG - Intronic
1121572873 14:94960752-94960774 TTCTGGAAGGAAAAGTGGGAAGG - Intergenic
1121970081 14:98347929-98347951 GTCTGTGAGGAGCAGAGGGAAGG - Intergenic
1123113057 14:105882019-105882041 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123115406 14:105892169-105892191 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123119657 14:105910887-105910909 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123165938 14:106324812-106324834 CTCTGTATGGAGAGGTGAAAAGG + Intergenic
1123168637 14:106349844-106349866 CTCTGTATGGAGAAGTGAAAAGG + Intergenic
1123948924 15:25252157-25252179 CTCCATGAGAAGAAGTGGGAAGG - Intergenic
1124926842 15:34078315-34078337 CTCTCTAAGGAGAGTTTGGAAGG + Intergenic
1125872725 15:43116893-43116915 CTCTGGGAGGCCAAGTGGGAGGG - Intronic
1126273908 15:46853674-46853696 CTCTGTATGGCCAAGTGGGCTGG - Intergenic
1128379880 15:67104758-67104780 CTCTGTCAAGAGAAGAGGGTGGG - Intronic
1128985447 15:72217234-72217256 CTTTGTCAGGACAAGAGGGAAGG + Intronic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1131872331 15:96775677-96775699 CTCTGGAAAGAGAACTGTGATGG - Intergenic
1134010068 16:10845382-10845404 CTCTAAAAAGAGAAGTGAGAAGG + Intergenic
1134069658 16:11253173-11253195 CTTAATAAGGTGAAGTGGGAGGG - Intronic
1134407640 16:13975910-13975932 CTATGAAAGTAGACGTGGGAAGG + Intergenic
1136073460 16:27802760-27802782 CTCTGGAGGCTGAAGTGGGAGGG - Intronic
1136620676 16:31426676-31426698 CTCTGTAATGGTAAGTGGGCAGG + Intergenic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1137361298 16:47818178-47818200 CTCTGGAGGCTGAAGTGGGAGGG + Intergenic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1140175790 16:72658414-72658436 CTCTGGAGGCTGAAGTGGGAGGG - Intergenic
1141402798 16:83765119-83765141 ATATGTAAGCAGATGTGGGATGG - Intronic
1141552813 16:84817497-84817519 ATCTGTAAGGAGATGAGGGTTGG + Intergenic
1141747849 16:85938088-85938110 CTCTGTATGGTTCAGTGGGAGGG + Intergenic
1141793040 16:86249555-86249577 CTCTGGAAGGTGAACTGGAAAGG + Intergenic
1141835566 16:86536789-86536811 CTCTGTGCGGAGCAGGGGGAGGG - Intronic
1141907899 16:87039771-87039793 CTGTGTAAAGAGCAGTGGGGGGG + Intergenic
1142214177 16:88822709-88822731 CCCTGCAATGAGAAGAGGGAAGG + Exonic
1142519584 17:495468-495490 CTCAGGAGGCAGAAGTGGGAGGG - Intergenic
1143214163 17:5211707-5211729 CTCTCTAAGAAGAAAGGGGATGG + Intronic
1143740030 17:8945714-8945736 CTCTTGATGGAGAAGTGGCAAGG - Intronic
1144382629 17:14717901-14717923 CTCTGGGAGAAAAAGTGGGAGGG - Intergenic
1145932656 17:28697108-28697130 TTCTGGAAGCAGGAGTGGGATGG - Intronic
1146182396 17:30706573-30706595 CTCTGTAGGGGGAAGTGGGTGGG + Intergenic
1147219306 17:38919245-38919267 CTGTGTAGGGACCAGTGGGATGG + Exonic
1147652136 17:42068809-42068831 GGCTTTAAGGAGAGGTGGGATGG - Intergenic
1148084755 17:44987435-44987457 CTCTGACAGGGGAGGTGGGATGG + Intergenic
1148940129 17:51201043-51201065 CTCTGAAGGCTGAAGTGGGAGGG + Intronic
1151723330 17:75870591-75870613 CTCTGTAAATGGTAGTGGGAGGG + Intergenic
1151842570 17:76628467-76628489 CTCTGCAAGGACAGGTGAGAAGG + Intronic
1152175540 17:78784531-78784553 CTCTGGAAGCTGAAGTGGGAGGG + Intergenic
1152308526 17:79535339-79535361 ATAGGTAAGGAGAAGAGGGAGGG + Intergenic
1152497878 17:80687183-80687205 GACAGTGAGGAGAAGTGGGACGG - Intronic
1153268344 18:3294522-3294544 CTCTTACAGGAGAAGAGGGAAGG + Intergenic
1155506457 18:26538277-26538299 CTCTGTAAAGAGAAATAGGAAGG + Intronic
1155656137 18:28195188-28195210 CTATTTAAGGAAAAGTGGGAAGG - Intergenic
1155678493 18:28459593-28459615 CCCTGTCAGTAGAAGAGGGATGG + Intergenic
1155702804 18:28768894-28768916 CTCTCTTAGGAGAAGTTGTAAGG + Intergenic
1156337357 18:36183510-36183532 CTCTGTGGGGATAAGTGTGATGG - Intergenic
1156515984 18:37680915-37680937 ATCTGTAAGGAAAAAAGGGAGGG + Intergenic
1157171889 18:45414865-45414887 CTCTGAAAGGAGAGAAGGGAAGG - Intronic
1157410011 18:47455619-47455641 GGCTGCAAAGAGAAGTGGGAAGG - Intergenic
1157446565 18:47750890-47750912 CTCAGTAAGGGGAACTGGGAGGG + Intergenic
1157877258 18:51285453-51285475 CTCTGTAGGGAGAACTCTGATGG + Intergenic
1160122839 18:76145996-76146018 TTCTGTTAGAAGGAGTGGGAGGG + Intergenic
1160424807 18:78772625-78772647 CTCTGCAAAGAGAGGTGGGCTGG + Intergenic
1161464791 19:4422908-4422930 CTCACGAAGGAGAAATGGGAAGG - Intronic
1161885843 19:6995056-6995078 ACCTGTGAAGAGAAGTGGGAAGG + Intergenic
1161941022 19:7404157-7404179 ATCTGTAAGAAGAAATGTGAAGG + Intronic
1162976428 19:14209228-14209250 CTCTGTAGGGGGAAGTGGGTGGG - Intergenic
1164055420 19:21618081-21618103 CTCTGGAAGGAGAAGACGAAGGG - Intergenic
1164738972 19:30562820-30562842 CTCAGGATGGAAAAGTGGGATGG - Intronic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
925337253 2:3107525-3107547 GCCTGTAAGGAGAGGTGGGATGG - Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926731380 2:16038280-16038302 CTCTGTCAGGGGAGGAGGGAGGG + Intergenic
927754351 2:25697002-25697024 CTTTGGAAGCTGAAGTGGGAGGG - Intergenic
927808331 2:26167846-26167868 CTCAGTAAGCTGAGGTGGGAGGG + Intergenic
929243590 2:39677644-39677666 CTGTGTTTGGAGGAGTGGGATGG + Intronic
929444391 2:41991535-41991557 CTCCAAAAGGAGGAGTGGGAGGG + Intergenic
929456592 2:42070601-42070623 GTCTTTAAGGAAAAGAGGGAGGG - Intergenic
929893452 2:45937861-45937883 CTCTTTAAAGAAAAGTGGGGTGG - Intronic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931066729 2:58596184-58596206 CCCTGTTGGGAGAACTGGGAAGG - Intergenic
932674067 2:73763158-73763180 CTCTGTAGGGAAAGGTGGAAAGG - Intronic
933969630 2:87459730-87459752 CTCAGGAAGGAGGAGTGGGCAGG + Intergenic
934042296 2:88137718-88137740 CTCTGAAGAGAGCAGTGGGAAGG + Intergenic
934173944 2:89563011-89563033 CCCTTCAAGAAGAAGTGGGAAGG + Intergenic
934284259 2:91637360-91637382 CCCTTCAAGAAGAAGTGGGAAGG + Intergenic
934776519 2:96941372-96941394 TTCTGAGAGGAGGAGTGGGAAGG + Intronic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
936169896 2:110161056-110161078 CTCAGGAAGCTGAAGTGGGAGGG + Intronic
936324156 2:111490767-111490789 CTCAGGAAGGAGGAGTGGGCAGG - Intergenic
938212431 2:129480023-129480045 CTCTTTAAGAAGCAATGGGAAGG + Intergenic
938433199 2:131264985-131265007 CTCCTTAGAGAGAAGTGGGATGG - Exonic
940413281 2:153390946-153390968 CAGGGTAAGGAGAATTGGGAGGG + Intergenic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG + Intronic
941241180 2:163040131-163040153 CTCTGAGGTGAGAAGTGGGAGGG + Intergenic
942913734 2:181277543-181277565 TTCTCGAAGGAGAAGTGGGATGG + Intergenic
943025778 2:182625607-182625629 CTCTGTCAGGACCAGTGAGATGG - Intergenic
945827177 2:214736411-214736433 CTCTGTAAGTACCATTGGGAAGG - Intronic
946168602 2:217880162-217880184 ATGTGTAAGGAGACGTGGGGCGG - Intronic
947486017 2:230549735-230549757 ACATGTAAGGACAAGTGGGAAGG - Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948363951 2:237442591-237442613 CTCTGTAGGGAGAGGGAGGAAGG + Intergenic
948815388 2:240507725-240507747 CTCTGTCAGGGGAAGTGACATGG - Intronic
1169129105 20:3154573-3154595 CTCAGGAGGTAGAAGTGGGAAGG + Intronic
1170401950 20:15996012-15996034 ATATGTAACCAGAAGTGGGATGG + Intronic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171779957 20:29409709-29409731 CTCTGGAAGGGAAAGAGGGAGGG - Intergenic
1171844874 20:30261537-30261559 CTCAGTAAGCTGAGGTGGGATGG - Intergenic
1171953395 20:31440999-31441021 GTGTGTGAGGAGGAGTGGGAGGG + Intronic
1172971007 20:38873039-38873061 CCCTGGCAGGAGAGGTGGGACGG - Intronic
1173648614 20:44649337-44649359 AGCTGGCAGGAGAAGTGGGAAGG - Intronic
1174573998 20:51524109-51524131 TTCTGGAAAGAGAAGGGGGAAGG + Exonic
1176372394 21:6069993-6070015 CTCTGCAAGGAAACGTGTGAGGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1177908889 21:27005967-27005989 CTCACTGAGGAGGAGTGGGAGGG - Intergenic
1179361476 21:40713456-40713478 CTCACTAAGGAGAGATGGGAAGG + Intronic
1179751124 21:43468546-43468568 CTCTGCAAGGAAACGTGTGAGGG - Intergenic
1180167821 21:46039134-46039156 CTCTGTGAGGAGAGCGGGGAGGG + Intergenic
1181824251 22:25501459-25501481 CTCTGAAAGGATAGGTGGCAGGG + Intergenic
1181937414 22:26448886-26448908 CTCTGTGAGGAGACAGGGGAGGG - Intronic
1182864092 22:33586820-33586842 CTGTGAAAGGAGCAGAGGGAGGG - Intronic
1182884814 22:33764271-33764293 CTCTGGAAGGAGAATTGAGTAGG - Intronic
1183364015 22:37397740-37397762 CAATGTAAGAAGAAGTGGGCAGG - Intronic
1183960177 22:41406717-41406739 CTCTGTATGGGGAAGAGGGGAGG - Intergenic
1185125333 22:49007345-49007367 CTCAGTAAGGAGGACTGGGAGGG + Intergenic
1185254214 22:49823311-49823333 CTCTGTAAGCAGAAGGGCGTGGG - Exonic
949722815 3:7010453-7010475 CTCTAAAAAGAAAAGTGGGAGGG + Intronic
950083277 3:10238929-10238951 CTCTGTGGGGAGAAGTGGGGTGG - Exonic
950459210 3:13111255-13111277 CTCTCTAATGAGAAGCAGGAAGG - Intergenic
952502455 3:33976743-33976765 CCCTGTGAGGAGAAGGGGCATGG + Intergenic
953974499 3:47371811-47371833 CTGTGGCAGGAGAAGTGGGGAGG - Intergenic
954189212 3:48944543-48944565 CCCTGTAAAGAAAAGTGGAATGG + Intronic
954758494 3:52856574-52856596 CTCTGGAAGCTGAGGTGGGAGGG + Intronic
959096413 3:101961281-101961303 CTCTAATAGGAGAACTGGGAAGG - Intergenic
961253239 3:125523978-125524000 CACTGAAAGGAGAAATGGGGTGG - Intergenic
961935780 3:130582072-130582094 CTGAGTATGGAGAAGTGGGAAGG + Intronic
962439861 3:135403549-135403571 CACTGTAATGAGCAGTGGGCTGG - Intergenic
962752218 3:138441634-138441656 CTCTGCTGGGAGTAGTGGGAGGG - Intronic
964153148 3:153552930-153552952 CTCTTTAAGAAGAAGTGTAAGGG - Intergenic
964948939 3:162263020-162263042 CTCTGTAATGGCATGTGGGAAGG + Intergenic
965505734 3:169512753-169512775 CCCTGCAGGAAGAAGTGGGAAGG - Intronic
965505747 3:169512801-169512823 CCCTGCAGGAAGAAGTGGGAAGG - Intronic
965807443 3:172556834-172556856 CTCAGTAAGGAGAATTGGGCCGG + Intergenic
966173954 3:177115030-177115052 CACTGTAAGGAGGAGTGAGGCGG + Intronic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
967249080 3:187518651-187518673 CTCTGTAAAGAAGTGTGGGAGGG - Intergenic
967874249 3:194256032-194256054 CAGTGTAAGGAGGAGTGTGAGGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
969059926 4:4426349-4426371 TTCTGTAAGCAGGAGTGGGAGGG + Intronic
969827794 4:9771827-9771849 CCCTTCAAGAAGAAGTGGGAAGG + Intronic
970423288 4:15924587-15924609 CCATGTAAGGAGGAATGGGAAGG - Intergenic
970820630 4:20207843-20207865 CACTGTAAGGAGTCGTGAGATGG + Intergenic
971018274 4:22510222-22510244 GCCTGAAAAGAGAAGTGGGATGG - Intronic
971356842 4:25902825-25902847 CTCTGGAAGCTGAGGTGGGAGGG - Intronic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
972492187 4:39598363-39598385 CTCTGGAGGGAGAAGTGGGTAGG - Intronic
972718894 4:41675903-41675925 CACTGTAGGGAAAAGTGGTATGG + Intronic
973726859 4:53785742-53785764 CTCTGTCAGGAGAGGAGAGATGG - Intronic
974060896 4:57034389-57034411 CTCTTAAAGGAGATCTGGGATGG - Intronic
974633892 4:64533455-64533477 CCCTTTCAGGGGAAGTGGGATGG - Intergenic
975231166 4:71935124-71935146 CTCTGCAAGGAGACTTGGCAGGG + Intergenic
975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG + Intronic
980107273 4:128599837-128599859 CTCTGTAAGGAAAGCTGTGAAGG - Intergenic
980333600 4:131440740-131440762 CCCTGTGAGGAGGAGTGGAATGG + Intergenic
981349383 4:143711290-143711312 CTCTGTATGGAGAATTTGAAGGG + Intergenic
982335260 4:154229406-154229428 TTTTGTAAGGGGAATTGGGATGG + Intergenic
983059587 4:163142868-163142890 CTGTATGAGGAGAAGTGGGCCGG - Intronic
983734995 4:171046158-171046180 CTCTCTAAGGAGGAGTAAGAAGG - Intergenic
986213630 5:5697981-5698003 CTCAGAAAGGAAAAGAGGGATGG + Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
986452738 5:7882288-7882310 CTCTGAAAGGAGGTGTGGGCAGG + Intronic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
988913457 5:35869263-35869285 CTCTGCTAAGAGAAGTGGGAAGG - Intronic
990849631 5:60188242-60188264 CTCTTTAAGGAGATGTTGGTAGG + Intronic
991212406 5:64120870-64120892 CTGAGTAAGGTGAAGAGGGAAGG + Intergenic
991920550 5:71652460-71652482 CTCTGTTAGGAGAGATGGGATGG + Intronic
993531571 5:89031166-89031188 CTCTGAAAGGAGTAAGGGGAAGG + Intergenic
993607185 5:90006205-90006227 CTCAGGAAGGAGTGGTGGGAAGG + Intergenic
994988996 5:106974658-106974680 TTCTGCAAGGAGAGGGGGGATGG + Intergenic
996700370 5:126444846-126444868 CCCTGTCAGGAGAGGTGGGAGGG - Intronic
996790680 5:127290399-127290421 CTCTGTAAGGATTTGTGGGACGG - Intergenic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997872046 5:137514862-137514884 CTCTAGAAGGAGAAGTTGCAGGG + Intronic
998051767 5:139041852-139041874 GACTGTAAGGAGAAGAGGGAGGG + Intronic
998667329 5:144312847-144312869 TTCTGTAAGGGGAAGTGACAAGG + Intronic
999085762 5:148888131-148888153 CTCTGGAAGGAGCAATGGCAGGG + Intergenic
999737120 5:154521230-154521252 CTCTGGAGGGAGCAGGGGGATGG - Intergenic
1000015164 5:157269275-157269297 GTAGGTAGGGAGAAGTGGGAGGG + Intronic
1001804776 5:174574014-174574036 CTCATTAAGGAGAAGGGAGAGGG + Intergenic
1002075774 5:176707653-176707675 CTCCGCAAGGAGGAGAGGGATGG + Intergenic
1002085748 5:176774425-176774447 CTCCGTGAGGAGAAGAGGAAGGG + Intergenic
1002467686 5:179416000-179416022 GTCTGCAAAGAGAGGTGGGATGG + Intergenic
1002820506 6:720240-720262 TTCTGAAAGGGGCAGTGGGATGG + Intergenic
1002941069 6:1716675-1716697 CTCTGTCAGGTGGAGTGGGTGGG - Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003411014 6:5863034-5863056 CTCTGTGAGGAGCAGAGGGCAGG + Intergenic
1003691810 6:8362271-8362293 GTCTGTAAGTGGAAGTGTGATGG - Intergenic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1004789784 6:19012038-19012060 CTCTGAAAGGAGAGGAGGCAAGG + Intergenic
1006313315 6:33276672-33276694 CTCTGTAAAGAGAAATGTGAGGG + Intergenic
1007220950 6:40278311-40278333 CCCTGTAAGGACAAGTATGAGGG + Intergenic
1007737831 6:43992890-43992912 CTCTGTTTGGAGGAGTGGGGTGG + Intergenic
1009796570 6:68476893-68476915 CTGGGGAAGGAGAAGTGGCAAGG - Intergenic
1010547146 6:77172808-77172830 CCCTGTAAGCAGATGTGGGCAGG + Intergenic
1011552040 6:88538825-88538847 ATCTGTAAGGAGAGGTGGGATGG - Intergenic
1012306401 6:97663377-97663399 CTCTGTGAGAAGATGTGGGCTGG + Intergenic
1012336474 6:98065397-98065419 CGCTGGAAGTGGAAGTGGGATGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015338848 6:132074534-132074556 CTCTGGAGGCTGAAGTGGGAGGG - Intergenic
1015627533 6:135195999-135196021 TTCTGTAAGTAGAATTGTGAAGG + Exonic
1016772405 6:147866428-147866450 CAATGTAATGAAAAGTGGGACGG + Intergenic
1017434969 6:154407121-154407143 CTCTGGAAGCAGAAATGGGAAGG + Intronic
1019688547 7:2396434-2396456 CTCTGCAAGGAGCGGTGGGACGG - Intergenic
1019956386 7:4418119-4418141 CGCTTTCAGGAGAAGAGGGAGGG - Intergenic
1021371528 7:19854558-19854580 CTCTGTTAGAAAAAGTGGCATGG - Intergenic
1021565709 7:22014460-22014482 CTATGTGATGAGCAGTGGGAGGG + Intergenic
1021593995 7:22295145-22295167 CTATGAAAAAAGAAGTGGGATGG + Intronic
1021982224 7:26065960-26065982 CTTTCTTGGGAGAAGTGGGATGG - Intergenic
1022975268 7:35550487-35550509 TTCTGAAAGGAAAAGTTGGACGG + Intergenic
1022985218 7:35647298-35647320 CTCTGCTTGGAGGAGTGGGAAGG - Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1026140188 7:67699065-67699087 CTCTGTTGGGGGAAGTGGGGTGG + Intergenic
1027539357 7:79449254-79449276 CTTTGAAAGGAGCAGTAGGAGGG + Intronic
1028941482 7:96526729-96526751 CTCTGAAAGGAGAAAGGAGAGGG - Intronic
1029180255 7:98695504-98695526 CCTTGTAAGGTGAAGTGAGAGGG - Intergenic
1030052009 7:105546316-105546338 GTCTGTCAGGAGGAGTAGGAAGG + Intronic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1032115931 7:129117051-129117073 CTCTGTAAGGGGAATAGGAATGG + Intergenic
1034260248 7:149751002-149751024 CTCTGTGAGGAGATGTCCGAAGG - Intergenic
1035072151 7:156153617-156153639 CTCTGGAGGGAGAAGCGGAAGGG - Intergenic
1035545881 8:482206-482228 CTCTGCAAGGAAGAGTGGGCAGG + Intergenic
1036719949 8:11164926-11164948 ATTAGTAAGGTGAAGTGGGAAGG - Intronic
1038682399 8:29681142-29681164 ATCTGAAAGTAGAAGTGGAAGGG - Intergenic
1039776000 8:40737329-40737351 CGATTTAAGGAGAAGAGGGATGG + Intronic
1041168564 8:55116440-55116462 TACTGTAAGGAGAAATAGGATGG + Intronic
1041692730 8:60704642-60704664 GGCTGTAAGCAGAAGTGGGTGGG + Intronic
1043219694 8:77645022-77645044 CTATGGAAGGAGAAGGGGAAGGG - Intergenic
1043458525 8:80436442-80436464 CTCTGGAAGCTGAGGTGGGAGGG + Intergenic
1044108056 8:88236639-88236661 CTCTGGAAGCTGAGGTGGGAGGG + Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1046977440 8:120297250-120297272 CTCTTTAAGTAGAAATGAGAGGG + Intronic
1049324234 8:142013722-142013744 CTCTGGAGGCAGAAGAGGGAAGG - Intergenic
1050459314 9:5863626-5863648 CTATGTAAGGATCAGAGGGAAGG + Intergenic
1052376566 9:27724255-27724277 TTGTGTAGGGAGAGGTGGGAGGG + Intergenic
1053132063 9:35621268-35621290 CCCTGTAATGAGTAGTGGGGAGG - Intronic
1053484748 9:38443259-38443281 CTGGGAGAGGAGAAGTGGGAGGG + Intergenic
1053602979 9:39629727-39629749 CTCTCTATGTAGAAGAGGGAGGG - Intergenic
1053860628 9:42383475-42383497 CTCTCTATGTAGAAGAGGGAGGG - Intergenic
1054250559 9:62712709-62712731 CTCTCTATGTAGAAGAGGGAGGG + Intergenic
1054564667 9:66747221-66747243 CTCTCTATGTAGAAGAGGGAGGG + Intergenic
1056455994 9:86760713-86760735 CTCTGGAGGCAGAAGTGGAAGGG + Intergenic
1057077605 9:92146967-92146989 CTCTGTAAAGAGAAATGGGAGGG - Intergenic
1057082219 9:92181441-92181463 CTCTGTGAGGAGAAGGGGCCAGG + Intergenic
1058555598 9:106163459-106163481 CTTTTTAAGTAGAAGAGGGAGGG + Intergenic
1060667017 9:125437988-125438010 CGCTGTAAGGAGAAGAGGAATGG + Exonic
1060881940 9:127123438-127123460 CTCTGTGAGGTCACGTGGGAAGG + Intronic
1060956794 9:127647229-127647251 CTCTGACAGGAGCAGTGAGATGG - Intronic
1062400220 9:136369396-136369418 GTCTGTAAGGTGGAGCGGGAAGG + Intronic
1185849928 X:3475779-3475801 ATCTGTACCCAGAAGTGGGATGG - Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1188137303 X:26505196-26505218 CTCTCTCAGGTGAAATGGGAGGG - Intergenic
1188817385 X:34731799-34731821 GTCTGTGAAGAGAAGTGGAATGG + Intergenic
1189201654 X:39201435-39201457 GTGTGTAAGAGGAAGTGGGAAGG - Intergenic
1191909989 X:66140007-66140029 CACTGAAAAGAGAAGTGGAATGG - Intergenic
1193167997 X:78303283-78303305 CACTGCTAGGAGATGTGGGAGGG + Intronic
1193765123 X:85518806-85518828 CTTTGTAATGACAGGTGGGAAGG - Intergenic
1196117568 X:112014076-112014098 CTCATTCAGTAGAAGTGGGATGG + Intronic
1197129471 X:122988366-122988388 CTTTGTAATGTGAAATGGGAAGG + Intergenic
1198343105 X:135733818-135733840 CTCGGGCAGGAGGAGTGGGAGGG + Intergenic
1198344884 X:135749477-135749499 CTCGGGCAGGAGGAGTGGGAGGG - Intergenic
1198458296 X:136838756-136838778 CCCTTTAAGCAGAAGAGGGATGG + Intergenic
1199467781 X:148158890-148158912 TTCTGTAAGCAGCAGTGGGAAGG - Intergenic
1199833553 X:151566389-151566411 CTCTGGAAGGAGAAGGCAGAGGG + Intronic