ID: 1076525397

View in Genome Browser
Species Human (GRCh38)
Location 10:131109517-131109539
Sequence CTGTTGTTCTCCCACTGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076525397_1076525408 29 Left 1076525397 10:131109517-131109539 CCGCCTCAGTGGGAGAACAACAG No data
Right 1076525408 10:131109569-131109591 AGAGTGTTTGACTCTGTCCGAGG No data
1076525397_1076525402 2 Left 1076525397 10:131109517-131109539 CCGCCTCAGTGGGAGAACAACAG No data
Right 1076525402 10:131109542-131109564 TCTTGTTCTGTCCCCCCGGCTGG No data
1076525397_1076525401 -2 Left 1076525397 10:131109517-131109539 CCGCCTCAGTGGGAGAACAACAG No data
Right 1076525401 10:131109538-131109560 AGGGTCTTGTTCTGTCCCCCCGG 0: 11
1: 639
2: 8320
3: 40786
4: 112016

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076525397 Original CRISPR CTGTTGTTCTCCCACTGAGG CGG (reversed) Intronic
No off target data available for this crispr