ID: 1076525400

View in Genome Browser
Species Human (GRCh38)
Location 10:131109520-131109542
Sequence ACCCTGTTGTTCTCCCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076525400_1076525402 -1 Left 1076525400 10:131109520-131109542 CCTCAGTGGGAGAACAACAGGGT 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1076525402 10:131109542-131109564 TCTTGTTCTGTCCCCCCGGCTGG No data
1076525400_1076525408 26 Left 1076525400 10:131109520-131109542 CCTCAGTGGGAGAACAACAGGGT 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1076525408 10:131109569-131109591 AGAGTGTTTGACTCTGTCCGAGG No data
1076525400_1076525401 -5 Left 1076525400 10:131109520-131109542 CCTCAGTGGGAGAACAACAGGGT 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1076525401 10:131109538-131109560 AGGGTCTTGTTCTGTCCCCCCGG 0: 11
1: 639
2: 8320
3: 40786
4: 112016

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076525400 Original CRISPR ACCCTGTTGTTCTCCCACTG AGG (reversed) Intronic
901044698 1:6388803-6388825 ACCCTGTGGTCCTCCCACCTTGG - Intronic
901117816 1:6862698-6862720 CCCCTGTTTCTCTCCCACTTAGG + Intronic
901136043 1:6996504-6996526 ACTTTGGTGTTCTCCCTCTGTGG + Intronic
906785982 1:48616377-48616399 ACCCTGTTCTTTTCTCACTCTGG - Intronic
907811255 1:57872626-57872648 TACATGTTGTTCTCCCAATGGGG - Intronic
908888664 1:68818131-68818153 ACCCAGTGGATCTCGCACTGGGG - Intergenic
909109904 1:71461950-71461972 TGCCAGTTGTTCTGCCACTGTGG - Intronic
910899849 1:92108150-92108172 CCCCTGTTGGACTCCCCCTGAGG - Intronic
912006723 1:104912129-104912151 CCCTTGTTGTGCTCCCAGTGGGG + Intergenic
912538677 1:110396268-110396290 ACCCAGTGGATCTCGCACTGGGG + Intergenic
914928135 1:151906560-151906582 ACCCAGTGGATCTCGCACTGGGG - Intronic
915228033 1:154425398-154425420 ACCCTATCATTCTCTCACTGAGG - Intronic
915666028 1:157446220-157446242 ACCCAGTGGATCTCCCACGGGGG + Intergenic
918059089 1:181046252-181046274 ACCCAGTGGATCCCCCACTGGGG - Intronic
919631022 1:199960043-199960065 ACCCAGTGGTTCCCGCACTGGGG - Intergenic
920275930 1:204804234-204804256 ACCATGGTCCTCTCCCACTGTGG - Intergenic
920877475 1:209850011-209850033 ACCCTCCCTTTCTCCCACTGAGG + Intronic
923416787 1:233770141-233770163 ACCCTGTTTTTGTTCCTCTGAGG + Intergenic
924826784 1:247548080-247548102 ACTCTTTTTTTCTCCCAATGAGG - Intronic
1063561551 10:7133035-7133057 ACTCTTTAGTTCTCTCACTGTGG - Intergenic
1063580040 10:7297933-7297955 AGCCCGTGGTGCTCCCACTGTGG - Intronic
1063910348 10:10822664-10822686 TCACTGTTTTTCTCCTACTGAGG + Intergenic
1063951489 10:11227226-11227248 ACCCTGTTGTTTTACTAATGAGG + Intronic
1067162881 10:43842286-43842308 ACCCTCTTCACCTCCCACTGTGG - Intergenic
1067355815 10:45525256-45525278 GCCCTGTTGTCCTGCTACTGAGG - Intronic
1068674891 10:59760552-59760574 ACCCTGTTTCTCCCCCACTCAGG + Intergenic
1069581332 10:69569037-69569059 ACGCTTTTGTCCTCCGACTGAGG + Intergenic
1070473842 10:76812868-76812890 ACTGTGGTGTTCTCCCACTCTGG - Intergenic
1070648080 10:78215328-78215350 CTCCTGTTGTTCTCCCACTAGGG - Intergenic
1070775602 10:79108091-79108113 ACCCATTTATTCTGCCACTGGGG + Intronic
1070957332 10:80473182-80473204 GCCCAGTGCTTCTCCCACTGAGG + Intronic
1071278098 10:84075122-84075144 TCCCCTTTGTTCTCCAACTGGGG - Intergenic
1074884333 10:117683044-117683066 ACCCTCTGGTTCTCTGACTGTGG - Intergenic
1075832099 10:125420072-125420094 TCACTTCTGTTCTCCCACTGAGG + Intergenic
1076525400 10:131109520-131109542 ACCCTGTTGTTCTCCCACTGAGG - Intronic
1077021357 11:418516-418538 ACCTTGTTCTTCACCGACTGAGG + Exonic
1079449112 11:20584041-20584063 AGCTTGTGCTTCTCCCACTGTGG - Intergenic
1079481456 11:20884994-20885016 ACCCTGCTATTCTCCGACTTCGG - Intronic
1080887095 11:36377079-36377101 ACTCTCTCGTTCTCCCTCTGGGG + Intronic
1081649124 11:44811909-44811931 ACCCTTCTGTTCTCCCCCTGGGG - Intronic
1084704042 11:70805478-70805500 CCCCTCTTGCTCCCCCACTGCGG + Intronic
1086184663 11:83999060-83999082 ACACTGCTGTCCTGCCACTGTGG - Intronic
1089062045 11:115633830-115633852 ACCCAGTGGATCTCGCACTGGGG + Intergenic
1090833883 11:130439673-130439695 ACCCTGCTGTTCTCCCACCATGG - Intergenic
1093733759 12:22595371-22595393 ACATTGTTGTTTTGCCACTGAGG + Intergenic
1095587486 12:43864323-43864345 ACCCAGTGGATCTCGCACTGGGG - Intronic
1097916495 12:65026045-65026067 TCCCTGTTGTTTTAACACTGGGG + Intergenic
1099104106 12:78478917-78478939 ACATTGTTATTGTCCCACTGGGG - Intergenic
1103439141 12:120950263-120950285 ACCCAGTGGATCTCCCACTGGGG + Intergenic
1103565531 12:121813401-121813423 ACCCTGCTGTCCTCACTCTGCGG - Intronic
1104829760 12:131742107-131742129 TCCCTGTAGTTCCCTCACTGGGG - Intronic
1106492578 13:30240499-30240521 AAGCTGTTGTTCTTCCAATGTGG - Exonic
1106938447 13:34749902-34749924 AGCCTGTTGTACTCACACTGTGG - Intergenic
1107360430 13:39611500-39611522 TCCCTGTTGTTCACCCTCTGGGG + Intergenic
1107516019 13:41130764-41130786 ACCCGGTTCTTTTTCCACTGTGG + Exonic
1109007836 13:56901153-56901175 ACCCAGTGGTTCTGGCACTGGGG - Intergenic
1109705909 13:66092583-66092605 AGCCTTTTGTTTCCCCACTGTGG - Intergenic
1110267471 13:73554742-73554764 CCCCTCTTGCTCTCTCACTGAGG - Intergenic
1110999765 13:82164884-82164906 ACCCAGTGGATCTCACACTGGGG + Intergenic
1112158147 13:96839935-96839957 TCCCTGTTTCTCTCCCACTACGG - Intergenic
1112581705 13:100681872-100681894 ACCCTGTTTTTCTCCAGCAGCGG + Intergenic
1112862142 13:103844739-103844761 ACTTTGTAGTTCTTCCACTGTGG + Intergenic
1117755564 14:58970900-58970922 ACCCTGTAGTTCTCCACCTGGGG - Intergenic
1120632229 14:86905361-86905383 ACCTGGTGGATCTCCCACTGGGG + Intergenic
1122405523 14:101498577-101498599 ACACTGATTTTCGCCCACTGAGG - Intergenic
1126089069 15:45035258-45035280 ACCCAGTGGATCTCGCACTGGGG - Intronic
1126353307 15:47767855-47767877 ACCATCTTTTTCTCCCCCTGAGG - Intronic
1128249166 15:66152723-66152745 CCCCTGCTGTCCTCCCACTGTGG + Intronic
1132097775 15:99000427-99000449 ACCCTGTGGATCCCGCACTGGGG - Intronic
1135145331 16:19956935-19956957 ACCCTGTTGTTCTGACACATGGG - Intergenic
1136226761 16:28865106-28865128 ACCTTCCTCTTCTCCCACTGGGG - Intronic
1139303314 16:65963149-65963171 GCCCTGTTCTTCTTCCACTAAGG + Intergenic
1139710941 16:68775515-68775537 CCCTTTTTGTTCTCCCACTTTGG + Intronic
1143386901 17:6536403-6536425 AAGCTGTTGTTGTCTCACTGTGG + Intronic
1144100727 17:11940020-11940042 ACAGTGTTTTTCTCCCACAGGGG + Intronic
1148773572 17:50080414-50080436 TCCCTGTTGTTCTCCCCCTCAGG - Intronic
1148905200 17:50907643-50907665 AACCCATTGTTCTCCCTCTGGGG + Intergenic
1149222606 17:54432990-54433012 AACCTGTTTTTCTACAACTGTGG + Intergenic
1151247616 17:72807141-72807163 ATCCTCTTCTTCTCCCTCTGAGG + Intronic
1152618967 17:81351970-81351992 ACCCAGTGGATCTCGCACTGGGG + Intergenic
1153102521 18:1489570-1489592 ACCATGTTGGTCTCAAACTGCGG + Intergenic
1155205140 18:23552063-23552085 ACCCTTTTGTCCTCCCTCTTTGG - Intronic
1156079570 18:33316581-33316603 ACCCAGTGGATCTCCCACTGGGG - Intronic
1161217595 19:3102224-3102246 ACCTTGTTCTGTTCCCACTGAGG - Intronic
1161500163 19:4610111-4610133 ACTGTGTTGTTCTCACACGGAGG + Intergenic
1162188135 19:8922937-8922959 ACCCTGCAGTTCTCTCTCTGTGG + Exonic
1162664970 19:12202612-12202634 ACCCCTTTGTTATGCCACTGGGG - Intergenic
1164523277 19:28995093-28995115 AGCCTGTGGTTCTCCAAGTGTGG - Intergenic
1167052311 19:47086708-47086730 ACCCTCTGGTTCTCTCAATGGGG + Intronic
1167139047 19:47636951-47636973 AACTTGTTGTTCTCCTGCTGTGG + Intronic
928024410 2:27728246-27728268 TCCCTGTTGTTCTTCCCCTCGGG - Intergenic
928617868 2:33057363-33057385 ACCCAGTGGGTCTCCCACTGGGG + Intronic
929569157 2:43009215-43009237 GCCATGTTGTTGTCCCAGTGGGG + Intergenic
929610791 2:43269340-43269362 AGCCTGTTGTTGTCTCTCTGGGG + Intronic
929945790 2:46370872-46370894 ACCCTGTACTTGGCCCACTGGGG + Intronic
930157434 2:48119778-48119800 ACCCTCTGGAGCTCCCACTGCGG - Intergenic
937608167 2:123826825-123826847 ACTGTGGTGTGCTCCCACTGCGG - Intergenic
937924270 2:127155518-127155540 ACATGGTTGATCTCCCACTGAGG - Intergenic
938139991 2:128787427-128787449 ACCCTGTAGTCCACCCACTCTGG + Intergenic
938285685 2:130113929-130113951 ACCCTGTTCTTCTCTTACCGGGG - Intronic
938336329 2:130502496-130502518 ACCCTGTTCTTCTCTTACCGGGG - Intronic
938353495 2:130618166-130618188 ACCCTGTTCTTCTCTTACCGGGG + Intronic
938429919 2:131224971-131224993 ACCCTGTTCTTCTCTTACCGGGG + Intronic
938474733 2:131598153-131598175 ACCCTGTTCTTCTCTTACTGGGG + Intergenic
939864715 2:147460005-147460027 CCCTTCTTGTTCTCACACTGTGG - Intergenic
940038769 2:149337569-149337591 ATCATCTTTTTCTCCCACTGTGG + Intronic
940731308 2:157395961-157395983 GCCCTGTTGTCCTAACACTGAGG + Intergenic
942147801 2:173043544-173043566 CCCCCTTTGCTCTCCCACTGCGG - Intronic
942548850 2:177093108-177093130 ACTCTCTTTTTGTCCCACTGTGG + Intergenic
942595012 2:177584422-177584444 ACCCAGTTGTTCTTCCACCCTGG + Intergenic
943942799 2:194020584-194020606 ACCCTGTGGATCCCACACTGGGG - Intergenic
943955028 2:194176787-194176809 ACCCATTGGATCTCCCACTGGGG - Intergenic
944058416 2:195547288-195547310 ACCCAGTGGATCTCACACTGGGG + Intergenic
944935320 2:204561480-204561502 ACCCTCTTGTTCTCTCACTGGGG - Intronic
945401460 2:209387758-209387780 ACCCAGTGGATCTCGCACTGGGG - Intergenic
945870292 2:215219486-215219508 ACCCAGTGGATCTCACACTGGGG - Intergenic
946579042 2:221106709-221106731 CACCAGTTGTTCTCCAACTGAGG + Intergenic
946859169 2:223983879-223983901 AACCTGTTCTTCACCCATTGAGG + Intronic
948449036 2:238057790-238057812 ACCCAGTGGATCCCCCACTGCGG + Intronic
1168972785 20:1942231-1942253 ACCCTGATGTTCTGACACTTTGG - Intergenic
1170550841 20:17474694-17474716 CCCTTGTTGTTCTGCCAGTGAGG + Intronic
1173371291 20:42438759-42438781 ACCATGTTGTCCTGCCAGTGAGG - Intronic
1175616989 20:60408172-60408194 ACCCTGTTGTTTTCATACTCTGG + Intergenic
1175976905 20:62715448-62715470 ACCCTGTGGTGCTCCCCGTGGGG + Intronic
1176869319 21:14073373-14073395 ATCCTGTTGCTTTCCCACGGAGG + Intergenic
1178298556 21:31431446-31431468 GCTCAGTGGTTCTCCCACTGTGG - Intronic
1178900408 21:36593459-36593481 ACCCTCCTCCTCTCCCACTGGGG - Intergenic
1180723198 22:17924780-17924802 TACCTGCTGTTCTCACACTGTGG - Intronic
1181492523 22:23269392-23269414 ACCCTGCGGTTCTCACACGGAGG - Intronic
1183110088 22:35642462-35642484 ACCTAGTTCTGCTCCCACTGTGG - Intergenic
1183235228 22:36611723-36611745 AGGCTGTTGTTCTAGCACTGTGG + Intronic
1183307757 22:37091942-37091964 ACATTGTTGTTCTCTCTCTGGGG - Intronic
1184066353 22:42123972-42123994 ATCCTCCTGTTCTCACACTGGGG - Intergenic
1184068821 22:42136124-42136146 ATCCTCCTGTTCTCACACTGGGG - Intergenic
950426646 3:12928018-12928040 ACCCTCTTGACCTCACACTGGGG - Intronic
952355455 3:32579138-32579160 ACCCAGTGGATCCCCCACTGGGG - Intergenic
952593718 3:34988801-34988823 ACCCAGTGGATCCCCCACTGGGG - Intergenic
954298080 3:49685192-49685214 CCTCTGTGGTTATCCCACTGGGG - Intronic
954881932 3:53842514-53842536 ACATTGTTGTTATCACACTGGGG - Intronic
955721209 3:61883355-61883377 TCCCTGTGGTTCTCCACCTGGGG + Intronic
956392126 3:68785249-68785271 ACCCAGTGGATCTCGCACTGGGG + Intronic
959823559 3:110766731-110766753 GCTCTCTTTTTCTCCCACTGGGG + Intergenic
960707000 3:120491387-120491409 ACGTTGTTGTTATCCCACTGAGG - Intergenic
961040798 3:123676682-123676704 CCACTGTGGTTCTGCCACTGGGG - Intronic
961354511 3:126327500-126327522 ACCCTGCTCCTCACCCACTGTGG - Intergenic
962847077 3:139282256-139282278 ACCTGGTTCTTCTCCCTCTGGGG - Intronic
963636407 3:147802759-147802781 ACCCAGTAGTTCTCACAGTGTGG + Intergenic
963766635 3:149343180-149343202 AGCCTGCTGGTTTCCCACTGGGG - Intergenic
964452073 3:156822613-156822635 ACCCAGTGGGTCTCGCACTGGGG + Intergenic
964806070 3:160611065-160611087 ACCCTGTTATTTTCATACTGTGG - Intergenic
964974251 3:162600127-162600149 ACCCAGTGGATCTCGCACTGGGG - Intergenic
965040374 3:163499448-163499470 ACCCAGTGGATCTCACACTGGGG - Intergenic
965074542 3:163959730-163959752 ACATTGTTGTTCTGCCACTGAGG - Intergenic
965773087 3:172201259-172201281 ACCCTGCGCTTCCCCCACTGGGG - Intronic
965803643 3:172519932-172519954 ACCCTGTGGACATCCCACTGTGG + Intronic
967016584 3:185487901-185487923 AGCCTGTCGTTCTGCCATTGGGG - Exonic
969544717 4:7818154-7818176 ACAGTGTTTTTCTTCCACTGAGG - Intronic
972764959 4:42144160-42144182 TTCCTGTTGTTCTGCGACTGCGG + Intronic
975412401 4:74069260-74069282 ACCCTGTTATTCTGACACAGGGG + Intergenic
977606842 4:98993417-98993439 ACCCAGTGGTTCCCGCACTGGGG + Intergenic
978019175 4:103786880-103786902 CCCCTGCTGTTTTCCCTCTGTGG - Intergenic
981202872 4:142002949-142002971 ACTCTTTTGTTCTCCAAATGTGG + Intergenic
986405287 5:7419375-7419397 CCCCTGTTGTCCTCTCTCTGTGG + Intronic
986441324 5:7784962-7784984 ACCCTTCTGGTCTCCCACAGAGG + Intronic
986799769 5:11246917-11246939 CCCCTGTTGGTCTCCCAGTAGGG - Intronic
990714098 5:58617252-58617274 ACCCTGCTGTTCAGCCACTTTGG + Intronic
991085134 5:62641952-62641974 ATCCTGTTTTTTTCCCACTGTGG + Intergenic
994620428 5:102155365-102155387 ACCCAGTGGATCTCCCACAGGGG - Intergenic
994769712 5:103966262-103966284 ACCCAGTGGATCTCGCACTGGGG + Intergenic
1000342034 5:160285374-160285396 ACCCTGTTCTCTTCACACTGGGG - Intronic
1002793276 6:450393-450415 ACCCAGTGGATCTCACACTGGGG - Intergenic
1003508764 6:6762416-6762438 ACCCAGTGGATCTCGCACTGGGG + Intergenic
1004234345 6:13860568-13860590 ACCCAGTGGATCTCCCACTGGGG - Intergenic
1004250379 6:14018421-14018443 ACTCTGTGGATCTCGCACTGGGG - Intergenic
1005574711 6:27180258-27180280 GCACTGTTGTTATCCCATTGAGG - Intergenic
1006078082 6:31547211-31547233 TCCCTGTTGTTGTCCCACTGTGG + Intronic
1006131107 6:31870042-31870064 ACCCTGTTGGTCCCACCCTGGGG - Intronic
1007026130 6:38576626-38576648 ACCCATCTGATCTCCCACTGTGG - Intronic
1007967175 6:46014082-46014104 AGCCTGTTCTCTTCCCACTGTGG - Intronic
1009023179 6:57967569-57967591 TTCCTGTTGTTTTCTCACTGGGG + Intergenic
1010658023 6:78535350-78535372 TCCCTGTTGTTCTCTTCCTGTGG - Intergenic
1014055963 6:117015178-117015200 ACCCAGTGGATCTCGCACTGGGG - Intergenic
1014280882 6:119441429-119441451 ACCCAGTGGATCTCGCACTGGGG - Intergenic
1015468445 6:133575040-133575062 ACCATGTTGGTCTCCAACTCCGG - Intergenic
1020265593 7:6557858-6557880 AGCCTGTCGGGCTCCCACTGCGG - Intergenic
1024350009 7:48353736-48353758 AGCCTTTTATCCTCCCACTGTGG - Intronic
1027735893 7:81932553-81932575 ACCGTATTGTTCTCCTACTTGGG + Intergenic
1028989583 7:97034771-97034793 ACCCAGTGGATCTCTCACTGGGG - Intergenic
1029275144 7:99399515-99399537 ACCTGGGTGTTCTGCCACTGTGG - Intronic
1029809562 7:103034179-103034201 ACCCAGTGGATCTCGCACTGGGG + Intronic
1031331650 7:120473135-120473157 ACCATGGTTTTCTCCCTCTGTGG - Intronic
1033058244 7:138079903-138079925 ACCTTGTAATTCTCCAACTGGGG + Intronic
1033065149 7:138146546-138146568 ACCCAGTGGATCTCGCACTGGGG - Intergenic
1033839831 7:145360531-145360553 ACCCAGTGGATCTCCCACGGAGG + Intergenic
1034967022 7:155398080-155398102 ACCCAGTGGATCTCGCACTGGGG + Intergenic
1035007333 7:155676071-155676093 ACAATTTTTTTCTCCCACTGGGG + Intronic
1036070315 8:5435354-5435376 GCCCTGTTGGAATCCCACTGTGG - Intergenic
1036454593 8:8895460-8895482 ACCCTTTTTTTCCCCCACAGAGG + Intergenic
1037191114 8:16126897-16126919 ACTCTGGTGTTCTCCCCATGAGG - Intronic
1037303399 8:17478195-17478217 GCTCTGCTTTTCTCCCACTGGGG + Intergenic
1037623651 8:20589186-20589208 ACACTGTGGTTCTCCAAGTGTGG + Intergenic
1037675814 8:21049989-21050011 CCCCTCTTGTTCTTCCAATGTGG - Intergenic
1038870773 8:31490292-31490314 ACCCAGTGGATCTCGCACTGGGG - Intergenic
1039842082 8:41301182-41301204 AACCTGATGTCTTCCCACTGGGG + Intronic
1040697786 8:50023070-50023092 ACCTTGTTGATCTCCCCTTGGGG - Intronic
1040954845 8:52969769-52969791 ACCCAGTGGATCTCACACTGGGG + Intergenic
1042979896 8:74514733-74514755 AATCTATTTTTCTCCCACTGGGG - Intergenic
1046208813 8:111040773-111040795 ACCCAGTGGATCTCGCACTGGGG + Intergenic
1046606981 8:116382306-116382328 ACCCTGCTGATCTCCTGCTGTGG + Intergenic
1046685146 8:117216492-117216514 ACTCTGTTGTTTTACCACTGGGG + Intergenic
1047360476 8:124164456-124164478 ACCCTTTTGTATACCCACTGAGG + Intergenic
1051965914 9:22829671-22829693 ACCATGTTGTTCTGCCACTCTGG + Intergenic
1052215700 9:25963671-25963693 TCCCTGCTGTTTTCCCTCTGTGG + Intergenic
1052375693 9:27715691-27715713 ACCCTGAGGTTCTCCACCTGTGG + Intergenic
1052673768 9:31592977-31592999 ACCCTTCTGTTCTCCCACCCTGG + Intergenic
1055014667 9:71603102-71603124 ACTCTGTTCTTCTCCCACATGGG + Intergenic
1059008119 9:110426501-110426523 ACTCTGTTGTTCACTAACTGTGG - Intronic
1059164041 9:112062023-112062045 ACACTGTAGTCCTCCAACTGAGG + Intronic
1060487095 9:124054616-124054638 AAGCTGTTGTTCTGCCAGTGGGG + Intergenic
1185674331 X:1836658-1836680 CCCCTGTTGTGCCTCCACTGAGG - Intergenic
1186185054 X:7012591-7012613 ATCCTCTTGTTCTCTCACTGAGG + Intergenic
1187376391 X:18758917-18758939 ACCCTTCAGTTCTCACACTGTGG - Intronic
1187991166 X:24874694-24874716 AGGCTGATGTTCTCCAACTGAGG + Intronic
1188112073 X:26205183-26205205 ACCCAGTGGATCTCCCACTGGGG - Intergenic
1189233705 X:39471757-39471779 ATCCTGTGGTTCTTTCACTGGGG - Intergenic
1190643273 X:52501430-52501452 AAACTGTTGTCCTGCCACTGGGG - Intergenic
1190644399 X:52511437-52511459 AAACTGTTGTCCTGCCACTGGGG + Intergenic
1191252827 X:58267553-58267575 AGGCTGTTGTTGTCCCACGGAGG - Intergenic
1192384399 X:70651364-70651386 ACAATGTTTTTTTCCCACTGTGG + Intronic
1193271139 X:79531006-79531028 ACCCAGTGGATCTCGCACTGGGG - Intergenic
1195696336 X:107670315-107670337 GTCCTGTTGTGCTCCCACTCAGG - Intergenic
1196295440 X:113991597-113991619 ACCCTGTTATTTTGGCACTGAGG - Intergenic
1197340119 X:125256058-125256080 ACCCAGTGGATCTCGCACTGGGG - Intergenic
1198439638 X:136650726-136650748 ACCTTGATGCTCTCGCACTGGGG + Intronic
1198872245 X:141188475-141188497 ACCCAGTGGGTCTCGCACTGGGG + Intergenic
1199320253 X:146429430-146429452 ACCCTGTTTTTCTCCCACATGGG + Intergenic
1200416770 Y:2920029-2920051 ACCCTGTTATTCTGACACAGAGG - Intronic