ID: 1076525401

View in Genome Browser
Species Human (GRCh38)
Location 10:131109538-131109560
Sequence AGGGTCTTGTTCTGTCCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161772
Summary {0: 11, 1: 639, 2: 8320, 3: 40786, 4: 112016}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076525400_1076525401 -5 Left 1076525400 10:131109520-131109542 CCTCAGTGGGAGAACAACAGGGT 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1076525401 10:131109538-131109560 AGGGTCTTGTTCTGTCCCCCCGG 0: 11
1: 639
2: 8320
3: 40786
4: 112016
1076525397_1076525401 -2 Left 1076525397 10:131109517-131109539 CCGCCTCAGTGGGAGAACAACAG No data
Right 1076525401 10:131109538-131109560 AGGGTCTTGTTCTGTCCCCCCGG 0: 11
1: 639
2: 8320
3: 40786
4: 112016

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076525401 Original CRISPR AGGGTCTTGTTCTGTCCCCC CGG Intronic
Too many off-targets to display for this crispr