ID: 1076525402

View in Genome Browser
Species Human (GRCh38)
Location 10:131109542-131109564
Sequence TCTTGTTCTGTCCCCCCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076525397_1076525402 2 Left 1076525397 10:131109517-131109539 CCGCCTCAGTGGGAGAACAACAG No data
Right 1076525402 10:131109542-131109564 TCTTGTTCTGTCCCCCCGGCTGG No data
1076525400_1076525402 -1 Left 1076525400 10:131109520-131109542 CCTCAGTGGGAGAACAACAGGGT 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1076525402 10:131109542-131109564 TCTTGTTCTGTCCCCCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076525402 Original CRISPR TCTTGTTCTGTCCCCCCGGC TGG Intronic
No off target data available for this crispr