ID: 1076525408

View in Genome Browser
Species Human (GRCh38)
Location 10:131109569-131109591
Sequence AGAGTGTTTGACTCTGTCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076525406_1076525408 -10 Left 1076525406 10:131109556-131109578 CCCGGCTGGAGTGAGAGTGTTTG 0: 1
1: 0
2: 0
3: 35
4: 781
Right 1076525408 10:131109569-131109591 AGAGTGTTTGACTCTGTCCGAGG No data
1076525405_1076525408 -9 Left 1076525405 10:131109555-131109577 CCCCGGCTGGAGTGAGAGTGTTT 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1076525408 10:131109569-131109591 AGAGTGTTTGACTCTGTCCGAGG No data
1076525404_1076525408 -8 Left 1076525404 10:131109554-131109576 CCCCCGGCTGGAGTGAGAGTGTT 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1076525408 10:131109569-131109591 AGAGTGTTTGACTCTGTCCGAGG No data
1076525403_1076525408 -7 Left 1076525403 10:131109553-131109575 CCCCCCGGCTGGAGTGAGAGTGT 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1076525408 10:131109569-131109591 AGAGTGTTTGACTCTGTCCGAGG No data
1076525397_1076525408 29 Left 1076525397 10:131109517-131109539 CCGCCTCAGTGGGAGAACAACAG No data
Right 1076525408 10:131109569-131109591 AGAGTGTTTGACTCTGTCCGAGG No data
1076525400_1076525408 26 Left 1076525400 10:131109520-131109542 CCTCAGTGGGAGAACAACAGGGT 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1076525408 10:131109569-131109591 AGAGTGTTTGACTCTGTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076525408 Original CRISPR AGAGTGTTTGACTCTGTCCG AGG Intronic
No off target data available for this crispr