ID: 1076525939

View in Genome Browser
Species Human (GRCh38)
Location 10:131112408-131112430
Sequence AGGGCTTGTGGGAGGCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 539}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076525939_1076525945 1 Left 1076525939 10:131112408-131112430 CCACTGTGCCTCCCACAAGCCCT 0: 1
1: 0
2: 5
3: 58
4: 539
Right 1076525945 10:131112432-131112454 ATGATGATGCCAGCTGCATGTGG No data
1076525939_1076525948 30 Left 1076525939 10:131112408-131112430 CCACTGTGCCTCCCACAAGCCCT 0: 1
1: 0
2: 5
3: 58
4: 539
Right 1076525948 10:131112461-131112483 TTCATTTTTGAGAAACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076525939 Original CRISPR AGGGCTTGTGGGAGGCACAG TGG (reversed) Intronic
900012335 1:127247-127269 AGGGTTTTTTGGGGGCACAGAGG - Intergenic
900063836 1:718224-718246 AGGGTTTTTTGGGGGCACAGAGG - Intergenic
900236486 1:1594104-1594126 AGGTCTCCTGGGAGGAACAGAGG - Intergenic
900538563 1:3191316-3191338 AGGGCCTGTGGGAAGCTCTGGGG + Intronic
900648781 1:3720963-3720985 GGGGCTGGTGAGGGGCACAGAGG + Intronic
900685316 1:3944481-3944503 GGGGCATGTGGGAGGGACAGAGG - Intergenic
901257330 1:7841421-7841443 ACAGCTTGTGGGAGTCAGAGTGG - Intronic
901451971 1:9341291-9341313 AGGGCATGAGGGAGGCAGTGGGG + Intronic
901671981 1:10861446-10861468 AGGGCCAGTGTGAGGCTCAGAGG + Intergenic
901696117 1:11009432-11009454 AGGGCCTGGGCCAGGCACAGTGG + Intergenic
902145433 1:14395021-14395043 AGGGCCTGTGCTAGGCACTGAGG - Intergenic
902232740 1:15037857-15037879 AGTCCTTCTGGGAGGGACAGAGG + Intronic
902288728 1:15423141-15423163 AGGGGTTCTGGGGGGCACAGCGG - Intronic
902643092 1:17779221-17779243 AGGGGTTGTGGGAGGGAGAGGGG - Intronic
902689185 1:18099216-18099238 AAGGCTATTGGGAGGCACATAGG - Intergenic
902779503 1:18695509-18695531 AGAGCTTGAGGGAGCCAGAGGGG - Intronic
902811910 1:18892722-18892744 ACAGCTAGTGGGAGGCAGAGTGG - Intronic
903173372 1:21567083-21567105 AGGTTTTGTGGAATGCACAGGGG - Intronic
903173653 1:21568540-21568562 GGGGCATGCGTGAGGCACAGAGG + Intronic
903179804 1:21599478-21599500 AGGCCTGGTGAGAGGCTCAGGGG - Exonic
903337879 1:22636891-22636913 AGGGCTTGGGGGAGGGTGAGAGG + Intronic
903704101 1:25272457-25272479 AGGGCTTGAGGGAGCGATAGGGG - Intronic
903722693 1:25417874-25417896 AGGGCTGGTGTTGGGCACAGGGG - Intronic
903723135 1:25420855-25420877 AGGGCTTGAGGGAGCGATAGGGG + Intronic
904586109 1:31581535-31581557 CAGGCTTGTGGGAGGCAGACGGG + Intronic
904789768 1:33010697-33010719 AGGGCTGGTGAGGGGCTCAGAGG - Intronic
906115232 1:43352320-43352342 AGGGTTGGTGGTGGGCACAGGGG - Intronic
906202980 1:43971754-43971776 AGGGCTGCTGGCAGGCACACTGG + Exonic
906275298 1:44510793-44510815 AGTGCTTCTGGGAGGCACTAAGG + Intronic
906593162 1:47047266-47047288 AGGGCTTATAGGAAGCAGAGGGG + Intronic
907661827 1:56400281-56400303 AGTGCTTGTGGGAGGCATAGTGG + Intergenic
907781876 1:57574274-57574296 AGGATTTGTGGGAGGTACAGAGG + Intronic
908545389 1:65157387-65157409 TTGGCTTGTGGGATGCAAAGAGG + Intronic
909879748 1:80859573-80859595 ACAGCTTGTGGGAGGCAGGGTGG + Intergenic
910431262 1:87161784-87161806 ATGGCCTGTTGAAGGCACAGTGG + Intronic
910708538 1:90155181-90155203 AGTGCTGTTGGGGGGCACAGTGG - Intergenic
911561995 1:99417834-99417856 AGTGCTATTGGGGGGCACAGCGG + Intergenic
912456771 1:109803350-109803372 ATAGCTTATGGGAGGCAGAGAGG + Intergenic
912637005 1:111305465-111305487 AGAGCTTGTGGGAGCCAGGGTGG - Intronic
912712640 1:111960815-111960837 AGGGCTGGTGGGAAGCACTCTGG - Intronic
912738989 1:112175853-112175875 AGGACTTGTAGGTGGCAAAGTGG - Intergenic
912757849 1:112339563-112339585 AGGGCTGGTGATAGCCACAGTGG - Intergenic
912795146 1:112688874-112688896 AGGGCTCGAGGGAGGCAGGGCGG - Intronic
914786444 1:150836752-150836774 AAGGCTTGGGCTAGGCACAGCGG + Intronic
914850175 1:151308355-151308377 AGAGATTGTGGGACGGACAGGGG - Intronic
915061784 1:153192121-153192143 AGGGCTTCTATTAGGCACAGAGG + Intergenic
915632955 1:157166180-157166202 AGGGTGTGTGGGAGGAACAGAGG - Intergenic
915836634 1:159181877-159181899 TGGGCTTGTGGTAGGCTGAGGGG - Intronic
915856113 1:159387858-159387880 AAGTGTTGTGGGAGGCACATGGG + Intergenic
915981176 1:160420764-160420786 AGGGCTGATGAGAGACACAGAGG - Intronic
916744424 1:167673800-167673822 AAGGCATGTTGTAGGCACAGGGG - Intronic
917056690 1:170990019-170990041 AGCCCTTGTGGAAGGGACAGAGG - Intronic
917059713 1:171023898-171023920 AAGGGTGGTGGGAGGCACTGGGG - Intronic
917478999 1:175394502-175394524 AGGGGTGGTGGGAGGAAAAGAGG - Intronic
918614233 1:186525992-186526014 TGGGCCTGTGGGAGGAGCAGGGG - Intergenic
918695128 1:187535982-187536004 ATTGCTTGTGGGATGCAAAGTGG - Intergenic
919425259 1:197421910-197421932 AGGGCCTGTGGCAGTCACACTGG - Exonic
919656648 1:200203184-200203206 AGGTCTTGTGGCAGGCATGGAGG - Intergenic
920277669 1:204819497-204819519 AGGGCTTCAGGGAGGGACACAGG + Intergenic
920443968 1:206001820-206001842 AGGGCTGGTGCCAGGCACTGGGG - Intronic
920726378 1:208439094-208439116 AGGGGTTGGGGGAGGGACGGGGG + Intergenic
921859497 1:220027002-220027024 AGGGCTTGGGCCGGGCACAGTGG + Intronic
922152928 1:223020747-223020769 AAGGCCTTTGGGAGGCCCAGTGG + Intergenic
922260767 1:223943715-223943737 AGGGTTTTTTGGGGGCACAGAGG - Intergenic
922479139 1:225926779-225926801 AGCGCTTGGGAGAGGCACAGGGG + Intergenic
922736302 1:227982016-227982038 AGGGTTTTTTGGGGGCACAGAGG + Intergenic
923385262 1:233459842-233459864 AGGGCTGGTCAGAGGCAGAGGGG - Intergenic
923538313 1:234869997-234870019 AGGGGTTGAGGGAGGAGCAGTGG - Intergenic
924066774 1:240231619-240231641 GGGGCTTGTAGTAGGTACAGTGG + Intronic
924222149 1:241888785-241888807 AGGGCTTAGGCCAGGCACAGTGG + Intronic
924289599 1:242524345-242524367 AGGGCGAGCGGGAGGCCCAGCGG + Exonic
924341943 1:243045901-243045923 AGGGTTTTTTGGGGGCACAGAGG - Intergenic
924501927 1:244645988-244646010 AGGGCCTATGAGAGCCACAGTGG + Intergenic
924554997 1:245110744-245110766 AGGGCATGTGTAAGTCACAGTGG + Intronic
924939427 1:248802504-248802526 AGGACCCGTGGAAGGCACAGGGG - Intergenic
1062923614 10:1298134-1298156 CTGGCATGTGGGAGGCACAATGG - Intronic
1062994516 10:1853384-1853406 AGTGCGTGTGTGAGGCCCAGAGG + Intergenic
1063204923 10:3821858-3821880 AGGGCATGCTGGAGGCAGAGCGG + Intergenic
1063541156 10:6935239-6935261 ATGGCTGGTGGAAGGCACTGGGG + Intergenic
1063583567 10:7331005-7331027 AGGCATTGAGGGAGGGACAGAGG - Intronic
1063869596 10:10403313-10403335 GGGGCATGTGGCAGCCACAGAGG + Intergenic
1064133768 10:12732681-12732703 ATGTGTTGTGGGAGGGACAGGGG - Intronic
1064272830 10:13880577-13880599 AGGACTGGTGGGAGTCACATGGG - Intronic
1064427838 10:15245676-15245698 AGGGAGTCTGGGGGGCACAGTGG - Intronic
1065533829 10:26698834-26698856 AAGGCTTGGGCCAGGCACAGTGG + Intronic
1065933317 10:30498515-30498537 AGGGCTGGGGCCAGGCACAGTGG - Intergenic
1066243718 10:33562049-33562071 AGGAATGGTGGGGGGCACAGAGG - Intergenic
1066474614 10:35733301-35733323 AGGGCTTGTGGGAGGAAGAATGG - Intergenic
1066492515 10:35907227-35907249 AGGGCTTGGGCCAGGCACAGTGG + Intergenic
1066712328 10:38249334-38249356 AGGGCCTGTTGGAGGGTCAGGGG + Intergenic
1066734540 10:38459638-38459660 AGGGTTTTTTGGGGGCACAGAGG + Intergenic
1067217744 10:44316726-44316748 AGGGCTGGTGGGAGGGGCAGAGG - Intergenic
1067217777 10:44316802-44316824 AGGGCTGGTGGGAGGGGCTGAGG - Intergenic
1067312458 10:45126935-45126957 AGGTCTCGGGGCAGGCACAGTGG + Intergenic
1067568213 10:47353087-47353109 AGGGCATGTGGGTGGCAGACAGG + Intronic
1068558313 10:58482722-58482744 AGGGCCTGGATGAGGCACAGTGG + Intergenic
1069150543 10:64954080-64954102 AGGGCTGTTGGGGGGCACTGTGG - Intergenic
1069889415 10:71643905-71643927 AGGGCTTGTGGTGGGCACAGTGG + Intronic
1069893302 10:71665325-71665347 AGGGGTAGTGGGAGGCAGTGGGG - Intronic
1069907709 10:71741587-71741609 AAAGCTTTTGGGAGGTACAGGGG + Intronic
1070088881 10:73264221-73264243 AGGGTTTGTGGGGGGACCAGAGG - Intronic
1070656269 10:78273774-78273796 AGGGCTTGTGGAGGTCACACAGG - Intergenic
1070767189 10:79063518-79063540 AGGGCTGTTGTGAGGCTCAGAGG + Intergenic
1071015896 10:80996974-80996996 AGTGCTGTTGGGAGGCACGGTGG - Intergenic
1071472026 10:85990361-85990383 AGAGCTTGTATGAGGCTCAGGGG + Intronic
1072721210 10:97782071-97782093 AGGGCTGGTGGGGGGCCCAGTGG + Intergenic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1073290739 10:102412049-102412071 ACGGCTTGTGGGGGACAGAGGGG + Intronic
1073452954 10:103620223-103620245 CGGGCTTCTGGGAAGCACTGGGG + Intronic
1074151038 10:110759995-110760017 AGTGGTGGTGGGGGGCACAGGGG + Intronic
1074198596 10:111210709-111210731 AAGGCATGTGGTAGGCACTGGGG + Intergenic
1074373881 10:112923008-112923030 GGGGATTGTGGGAGGCACTGTGG - Intergenic
1075458396 10:122599721-122599743 AGGGCTTGAGGACGGCACAAGGG + Intronic
1075477950 10:122752914-122752936 AGGAGTTGGGGGAAGCACAGTGG - Intergenic
1076171319 10:128322518-128322540 AGGGCTGGTTGGAGGCAGAGTGG - Intergenic
1076525939 10:131112408-131112430 AGGGCTTGTGGGAGGCACAGTGG - Intronic
1076563952 10:131385851-131385873 AGGGATAGAGGGAGGAACAGAGG + Intergenic
1076968667 11:119451-119473 AGGGTTTTTTGGGGGCACAGAGG - Intergenic
1076999480 11:315574-315596 AGGCCCTGTGGGAGGGGCAGGGG + Intergenic
1077108723 11:852936-852958 AGGGCATGGGGGAGCCCCAGTGG + Intronic
1077221637 11:1420616-1420638 AGGACTTGGGGGAGTCACAGGGG - Intronic
1077285527 11:1763688-1763710 GGGGCTCGTGGGGGCCACAGGGG + Intronic
1077670993 11:4157419-4157441 AGGGCTTGGTCAAGGCACAGTGG + Intergenic
1077893797 11:6438904-6438926 AGGCATTGTGAGAGGCACTGAGG + Intronic
1078288560 11:9983227-9983249 AGGGCTACTGGGGGGCACAGCGG + Intronic
1078359418 11:10656920-10656942 AAGGATGGTGGGAGGCAGAGGGG + Intronic
1078545963 11:12247175-12247197 AGGCCTTGTCAGAGGCCCAGAGG + Intronic
1079118082 11:17653422-17653444 AGGGCTTTTGGAAGGCCTAGTGG - Intergenic
1079158637 11:17972834-17972856 ATGGCTTTTGGGAGGCCCAAGGG + Intronic
1080020627 11:27555925-27555947 AGCGTTGGTGGGAGGCCCAGAGG - Intergenic
1080044747 11:27797191-27797213 GGGGCTTGTGGGAGAGGCAGTGG + Intergenic
1080112051 11:28579474-28579496 GGGGCAAGAGGGAGGCACAGTGG - Intergenic
1080443775 11:32318546-32318568 GGTGCTGGTGGGAGGCAAAGAGG - Intergenic
1080659111 11:34281465-34281487 AGGGCCCAGGGGAGGCACAGAGG - Intronic
1080959737 11:37145027-37145049 AGGTGTTGTGGGAGGGACTGTGG - Intergenic
1081705251 11:45179125-45179147 GGGGCTTGTGGAGGGCAGAGGGG + Intronic
1082952350 11:58830929-58830951 CGAGCCTGTGGGAGGCAGAGGGG - Intergenic
1083138877 11:60705182-60705204 AGTGGTTGTGGGAGGGAAAGGGG - Intronic
1083334103 11:61912884-61912906 GGGAATTGTGGGAGGAACAGGGG + Intronic
1083544489 11:63538368-63538390 GGGGGTTGTGGGGGTCACAGAGG + Intronic
1083681984 11:64355487-64355509 AGAGCTTGCAGGAGACACAGGGG - Intronic
1084122349 11:67077119-67077141 AGGCATTGTTTGAGGCACAGGGG - Intergenic
1084524944 11:69690926-69690948 AGGGAAGGTGGGAGGGACAGTGG + Intergenic
1085527666 11:77173629-77173651 AGGCCTGCAGGGAGGCACAGGGG + Intronic
1085776279 11:79369680-79369702 AGAGCTTGTAGGATGGACAGAGG - Intronic
1085799483 11:79575777-79575799 ATTGCTTTTGGGGGGCACAGGGG + Intergenic
1086419604 11:86625629-86625651 AGACCTTGTGCCAGGCACAGGGG + Intronic
1088005535 11:104934707-104934729 GGGGCTTGTGAGGGGCTCAGGGG + Intergenic
1088178808 11:107085498-107085520 AGGGATTCTGAGAGGTACAGTGG + Intergenic
1088976357 11:114819799-114819821 AGGCCCTGTGGTAGTCACAGGGG + Intergenic
1089299387 11:117489495-117489517 AGGGCTAGGGCTAGGCACAGTGG + Intronic
1089334759 11:117715605-117715627 AGGCCCTGTGCCAGGCACAGGGG - Intronic
1089383273 11:118051295-118051317 CTGGCTTGTGGGAGACCCAGGGG - Intergenic
1089466575 11:118689881-118689903 GGGGCTGCTGGGAGGCAGAGCGG - Intergenic
1089487262 11:118856293-118856315 AAGGATTGTGGGGTGCACAGTGG + Intergenic
1089699826 11:120237897-120237919 AGGGCTTATTGGAGGCCCAAGGG - Intronic
1089733529 11:120534413-120534435 AGGGCAAGTAGGGGGCACAGGGG + Intronic
1089748215 11:120631831-120631853 TGGGCTTGTAGGAGGCACACAGG + Intronic
1089814814 11:121162762-121162784 AGGGCAGGTGGAAGGCAGAGCGG + Intronic
1090447392 11:126775939-126775961 ATGGCTTGGGGGAGGTACAATGG + Intronic
1092089394 12:5791740-5791762 AGGGTTGCTGTGAGGCACAGAGG + Intronic
1092847808 12:12600370-12600392 AGGGCGTGGTGGAGGCACACTGG + Intergenic
1093523047 12:20072744-20072766 AGGGCTTGTTGGAGGTGGAGGGG + Intergenic
1095506550 12:42904988-42905010 AGGGGTGGGGGGAGGCACACAGG - Intergenic
1095822478 12:46493614-46493636 AAGGATTGTGGGAGACACATAGG - Intergenic
1095923197 12:47551820-47551842 AGCCCTTTTGGGAGGCAAAGTGG - Intergenic
1096033494 12:48442506-48442528 AGGGCTGGTGGGGGGCTCATGGG - Intergenic
1096238274 12:49944235-49944257 AGGGCCTGTGCTAGGCACTGCGG + Intergenic
1098386904 12:69929287-69929309 AGGGCATGTGGGAGGCAGAAAGG + Intronic
1098393783 12:69996949-69996971 AGGGCCCATGGGAAGCACAGAGG - Intergenic
1098882052 12:75926807-75926829 TGGGCTTGTCGGAGGTCCAGGGG - Intergenic
1098882768 12:75933413-75933435 AGAGCTTCTGGGAGGCCAAGGGG - Intergenic
1101279864 12:103241739-103241761 AGGCATTGTGGGAGAGACAGAGG + Intronic
1101343080 12:103860316-103860338 ATGTCTTGTGTGAGGCACTGAGG + Intergenic
1101991127 12:109486087-109486109 AGAGCTTGTGGGAGACACTGCGG - Intronic
1104013931 12:124950133-124950155 AGGGCAGGTAGGTGGCACAGCGG - Exonic
1104967288 12:132514005-132514027 AGGGCCTGGGGGAGGGACTGTGG - Intronic
1106076246 13:26463916-26463938 GAGGCTTGCTGGAGGCACAGGGG - Intergenic
1106288781 13:28341716-28341738 AGGGATTGGGGGAGGCAAAGAGG - Intronic
1106488848 13:30197392-30197414 AGGGCTTCTGGGAGACAGAAGGG + Intergenic
1106520658 13:30494798-30494820 AGGGGTTGGGGGAGGGAAAGGGG - Intronic
1106526075 13:30542390-30542412 CAGGAGTGTGGGAGGCACAGGGG - Intronic
1106526993 13:30549680-30549702 AGTGTTTGTGCCAGGCACAGTGG - Intronic
1106602340 13:31199120-31199142 AAGGCTTGAGGGAGGCACGAAGG + Intergenic
1107635961 13:42392848-42392870 TGGGCCTATTGGAGGCACAGAGG + Intergenic
1108530735 13:51324973-51324995 TGGGCTGGTGGGGGGCACGGTGG - Intergenic
1110588371 13:77222637-77222659 AAGGCTTGTGGGTGGGACAGGGG - Intronic
1113365893 13:109675563-109675585 AGGGTTGGGGGGAGGCACTGGGG + Intergenic
1113893720 13:113749745-113749767 GGGGCTGGAGGGAGGCACACGGG - Intergenic
1114532352 14:23403838-23403860 AGGGCTTCTGGGCTGAACAGAGG - Intronic
1115340697 14:32290804-32290826 AGGGCATGTCAGAGGCCCAGAGG + Intergenic
1115378247 14:32703151-32703173 TGGGCATGTTGGAGGCAGAGTGG + Intronic
1115511884 14:34145951-34145973 AGGGCCTGTCGGGGGCTCAGGGG + Intronic
1116049063 14:39781363-39781385 AGGGCTTTTGAGGGGCACGGTGG - Intergenic
1117189224 14:53274640-53274662 AGGCAATGTGGGACGCACAGTGG + Intergenic
1117913661 14:60656403-60656425 CCCGCTTGTGGGAGCCACAGGGG - Intronic
1117986006 14:61386740-61386762 AGTGCTGGTGGGAGGCAGGGAGG + Intronic
1118899444 14:69974256-69974278 AGGGTGTGTGGGAGGATCAGAGG + Intronic
1119147353 14:72329441-72329463 AGTGGTTGTGGAAAGCACAGAGG + Intronic
1120054232 14:79903747-79903769 AGAGCTTGTGGGAGCCAAGGTGG - Intergenic
1121311926 14:92940059-92940081 AGGGCTTGGGCGAGGGGCAGAGG - Exonic
1121812885 14:96907188-96907210 AAGGCTTGTGTGGGGAACAGGGG + Intronic
1121888022 14:97562426-97562448 AGGGCAGGTGTGAAGCACAGGGG + Intergenic
1124121728 15:26894052-26894074 AGGGCGTCTGGGGAGCACAGGGG - Intronic
1124577656 15:30923994-30924016 AGGGCTTGGGGAAGGGAAAGCGG - Intronic
1125967826 15:43888384-43888406 AGGGCCTGTGGGACCCACTGAGG + Intronic
1126381457 15:48051439-48051461 AGGCAATGTGGGAAGCACAGTGG + Intergenic
1127484957 15:59410463-59410485 GGTGAGTGTGGGAGGCACAGAGG - Intronic
1128032022 15:64489465-64489487 TAGGCTTGTGCCAGGCACAGTGG - Intronic
1128750717 15:70147228-70147250 AGGGCTGGAGACAGGCACAGTGG - Intergenic
1128767398 15:70259538-70259560 AGGGAGTGGGGGAGGCACACAGG - Intergenic
1129296163 15:74601405-74601427 AGGCCTTGTGTGTGGCGCAGTGG + Intronic
1129464605 15:75716843-75716865 ACGGCTTGTGTGTGGCTCAGAGG - Intergenic
1129522173 15:76192848-76192870 AGGGCTGCTGCGAGGCTCAGAGG + Intronic
1129720639 15:77876169-77876191 ACGGCTTGTGTGTGGCTCAGAGG + Intergenic
1129750541 15:78059764-78059786 AGAGCTGGTGGGAGGCTGAGGGG - Intronic
1130603767 15:85296662-85296684 AAGCTTTGTGGGAGCCACAGTGG - Intergenic
1131098181 15:89669204-89669226 GGGGCTTGTGGGAGACTCAGAGG + Intronic
1132806342 16:1776853-1776875 AGGTCTTGTGGGAGGCTGCGAGG - Exonic
1132958828 16:2611063-2611085 TGGCCTTGTGGGCAGCACAGGGG + Intergenic
1133026295 16:2990309-2990331 AGGGCTCGTGGGAGAGAGAGAGG - Intergenic
1133451686 16:5909377-5909399 AGGGCTTGGGCCGGGCACAGTGG - Intergenic
1133772200 16:8873625-8873647 AGCACTTTTGGGAGGCAGAGAGG - Intergenic
1133772747 16:8877132-8877154 ACGGCTTGTGGGGGGCGCAGTGG - Intergenic
1134247105 16:12548188-12548210 TGGCCTTGTGGGAGGCGCTGTGG - Intronic
1134469822 16:14514013-14514035 AGGGATTGTTGTAGGCACAGGGG + Intronic
1134561333 16:15212622-15212644 GGGGCTTTTGGGAGGTACACAGG + Intergenic
1134666941 16:16025528-16025550 AGGGGTTGTGGGGGGCACTTTGG + Intronic
1134921871 16:18124242-18124264 GGGGCTTTTGGGAGGTACACAGG + Intergenic
1137609570 16:49809748-49809770 AGGGCTTGGTGGAGGCACTTTGG - Intronic
1137625485 16:49905377-49905399 AGGCTCTGTGGGAGGCAGAGGGG - Intergenic
1138117162 16:54369882-54369904 ACCGCTTGTGAGAGGCAGAGTGG - Intergenic
1138424064 16:56918719-56918741 AGAGATTGAGGGAGACACAGTGG + Intergenic
1138610301 16:58118190-58118212 AGGGCTGGGGCCAGGCACAGTGG + Intronic
1139280186 16:65763940-65763962 AGAGCTGGTGGGAGGCGCAGAGG + Intergenic
1139356331 16:66368994-66369016 AGGGCTTGCTGGAGGAAGAGTGG + Intronic
1140078315 16:71722852-71722874 AGGGGTTGTGGGAGGCTGACTGG - Intronic
1140878607 16:79176717-79176739 AGGGCTTTAAGGAGGCATAGTGG + Intronic
1141096582 16:81167414-81167436 AGGGCTTCTGGGAGGCAGTGTGG - Intergenic
1141717577 16:85735630-85735652 AGGGCTCGGGGGTGGCCCAGAGG + Intronic
1142121557 16:88388964-88388986 AGGGCTGGTGTAAGGCACAGAGG - Intergenic
1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG + Intergenic
1142452009 16:90179671-90179693 AGGGTTTTTTGGGGGCACAGAGG + Intergenic
1142594051 17:1021048-1021070 AGGGCTTGTGGGAGGGGAGGTGG - Intronic
1143739472 17:8941997-8942019 GGGGCTTCAGGGAGGCTCAGGGG + Intronic
1143820492 17:9557674-9557696 AGGGCTGGAAGGAGGCTCAGTGG + Intronic
1144747475 17:17625439-17625461 AGGGCTGCTGGAAGGGACAGAGG + Intergenic
1144881889 17:18434694-18434716 AGGGGTTGTGGGAGAAAGAGTGG - Intergenic
1145150344 17:20509692-20509714 AGGGGTTGTGGGAGAAAGAGTGG + Intergenic
1145254305 17:21314330-21314352 AGGGCATCTGGGAGGAACCGAGG + Exonic
1145322292 17:21773632-21773654 AGGGCATCTGGGAGGAACTGAGG - Intergenic
1145909425 17:28534021-28534043 AGGGCTGGTGGGCGCTACAGAGG - Intronic
1147598063 17:41729260-41729282 AGGTCTTGGGACAGGCACAGTGG + Intronic
1147667228 17:42156419-42156441 AGGGCTTGTTGGGAGGACAGAGG + Intergenic
1147741931 17:42674887-42674909 AGGACAGGTGGTAGGCACAGAGG + Intronic
1148087681 17:45004260-45004282 AGGGGATGTTGGAGGCACAGAGG + Intergenic
1148637863 17:49162935-49162957 AGGGCAAGAGGGTGGCACAGGGG + Intronic
1149072492 17:52559164-52559186 GGGCCTGGTGGGAGGCACATTGG + Intergenic
1149301395 17:55307611-55307633 GGGACTTTTGGGAGGAACAGGGG - Intronic
1149451286 17:56751899-56751921 AGTGCTTGTAGGAGACATAGTGG - Intergenic
1151625753 17:75274525-75274547 AGGGCACGTGGGAGGACCAGTGG - Intronic
1151713391 17:75819214-75819236 AGGTCCTGTGGCAGGCACTGAGG + Intronic
1151990809 17:77572816-77572838 AGGGCGTGTGGCAGGCAAGGGGG - Intergenic
1152140389 17:78533042-78533064 AGAGCTTGGGCCAGGCACAGTGG - Intronic
1152157179 17:78642100-78642122 GGGGCTTGTGAGAGTCACAGAGG + Intergenic
1152218649 17:79048923-79048945 AGGGCTCTGGGGTGGCACAGGGG - Exonic
1152343762 17:79739287-79739309 GGAGGTTGTGGGATGCACAGCGG + Intronic
1152436549 17:80279754-80279776 AGGATTTGGGGCAGGCACAGTGG - Intronic
1152502383 17:80721050-80721072 AGGCCTCGTGGGAGGCACCTAGG + Intronic
1152601437 17:81264189-81264211 GGGGCCTGTGGGGAGCACAGCGG + Intronic
1152645115 17:81465220-81465242 AGGGGTTGGGGCAGGCAGAGGGG - Exonic
1152783134 17:82235267-82235289 AGGGCCGGTGGGAGGCAAGGGGG + Exonic
1152822031 17:82442335-82442357 AGGGCTGGTGGGTGGCAGCGGGG - Exonic
1152858424 17:82679958-82679980 AGTGGCTGTGGGAGGGACAGAGG + Intronic
1153550343 18:6256432-6256454 GGGGGTTGTTGGAGGAACAGAGG - Intronic
1153739349 18:8106637-8106659 AGGCCTTGTTCCAGGCACAGGGG - Intronic
1155053614 18:22167818-22167840 AGTGATTGGGGGAGGCAAAGTGG + Intergenic
1155230022 18:23763648-23763670 AGGCCTTGTGTGAGCAACAGTGG - Intronic
1155671751 18:28379947-28379969 AGAGCTTGTGGGAGGCAGGGTGG + Intergenic
1156041865 18:32832049-32832071 AGGGCTGGTATGAGGAACAGAGG - Intergenic
1156997295 18:43483043-43483065 AGGCAATGTGGGAAGCACAGTGG - Intergenic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1157458009 18:47855005-47855027 AGGCTTTGTGGGAGGTAAAGAGG - Intronic
1158551269 18:58438180-58438202 GTAGATTGTGGGAGGCACAGAGG - Intergenic
1158559881 18:58504978-58505000 AGAGGTTGGGGGAGGCAGAGGGG + Intronic
1158607403 18:58907815-58907837 AAGTCTTGTGGGAAGCTCAGGGG - Intronic
1158689072 18:59644068-59644090 AGGGTTTAAGGGAGGCCCAGGGG + Intronic
1160645476 19:189378-189400 AGGGTTTTTTGGGGGCACAGAGG - Intergenic
1161268308 19:3375358-3375380 GGGGGTGGTGGGGGGCACAGTGG - Intronic
1161559583 19:4965063-4965085 AGGGCCTGGGGGAGGGACACAGG - Intergenic
1161741208 19:6022127-6022149 AGGGGTTGTGGGAGGCGCAGGGG + Intronic
1161927519 19:7312351-7312373 AGGGAATCTGGGAAGCACAGTGG - Intergenic
1162304451 19:9863286-9863308 AGGCCTTGTGGGAAGCAGTGAGG + Intronic
1162867966 19:13563223-13563245 AGAGCTTTGGCGAGGCACAGTGG - Intronic
1163175625 19:15562474-15562496 AGGTGGGGTGGGAGGCACAGGGG - Intergenic
1163270847 19:16252568-16252590 AGGGCACGGGGGAGCCACAGCGG + Intergenic
1163433581 19:17282365-17282387 AGGGCTCGAGGGAGGCGCTGGGG + Intronic
1163582488 19:18146833-18146855 GGGCCCTGTGAGAGGCACAGAGG + Intronic
1164120717 19:22262523-22262545 ATGCATTGGGGGAGGCACAGGGG - Intergenic
1165171549 19:33895383-33895405 AGGTGTTGTTTGAGGCACAGTGG - Intergenic
1165758865 19:38309169-38309191 TGGGCCTGTGGGGGGCTCAGGGG - Intronic
1166149176 19:40858922-40858944 AGGCCTGATGGGAGGCACATAGG - Intronic
1166668997 19:44698582-44698604 AGGCCAGGTGAGAGGCACAGAGG - Intergenic
1167404176 19:49293459-49293481 AGGGCTGGTGGCAGACCCAGTGG + Intronic
1167492594 19:49801110-49801132 AGGGCTTGGGGGATCCCCAGGGG + Intronic
1167628417 19:50607593-50607615 AGGGGTTGTGACAGGCACCGAGG - Intergenic
1168241667 19:55091998-55092020 AGGGCTTGTGGGCTGCCTAGTGG - Intronic
1168263770 19:55209916-55209938 GGGGCTTGTGGGAGACGGAGAGG - Intergenic
1168424461 19:56227765-56227787 AGGGTGTGTGGCAGGCAAAGTGG + Intronic
925300199 2:2806333-2806355 AGGTCCTGTGGGAGGTACCGGGG - Intergenic
925763315 2:7207555-7207577 AGGGGATGTGAGTGGCACAGGGG + Intergenic
926058345 2:9789764-9789786 AGGGCATGTGGAGGGCACGGAGG + Intergenic
926275511 2:11400288-11400310 AGGTGGTCTGGGAGGCACAGAGG - Intergenic
927857894 2:26538504-26538526 AGGGCATGTTGGGAGCACAGAGG + Intronic
927913966 2:26922298-26922320 TGGGCTGGGGGCAGGCACAGAGG + Intronic
928508087 2:31974679-31974701 AGGGTTGCGGGGAGGCACAGAGG + Intronic
928864116 2:35896349-35896371 TGTGCTTGGGGGAGGCACAGTGG - Intergenic
930477655 2:51903756-51903778 AGAGCTTGTGAGAGCCAGAGTGG + Intergenic
930678515 2:54230651-54230673 AAGGATTGAGGCAGGCACAGTGG - Intronic
930910789 2:56627064-56627086 AGAGCTTGTGGGAGAGACAAAGG + Intergenic
931300293 2:60973003-60973025 AGGGGTTGTGGGAGCAGCAGTGG + Intronic
933491198 2:82987012-82987034 AGGGTTTGGGGGAAGCAGAGAGG - Intergenic
933551347 2:83781027-83781049 ATAGCTTGTGGGAGCCAGAGAGG + Intergenic
933729171 2:85444513-85444535 AGGGCTGGTGGGGGGCATCGGGG - Intergenic
933779843 2:85794049-85794071 AGGGCTGGGGGGAGGCAGGGAGG - Intergenic
934613682 2:95758451-95758473 AGGGCTTGCCTGAGGCAGAGAGG + Intergenic
934840593 2:97621784-97621806 AGGGCTTGCCTGAGGCAGAGAGG - Intergenic
934876160 2:97922999-97923021 ATGGCTTTTGCCAGGCACAGTGG + Intronic
934949860 2:98568966-98568988 AGGACTTGGGGGAATCACAGAGG + Intronic
936239189 2:110772460-110772482 AGGGCTTGTGGGTGGCTCATAGG + Intronic
937287359 2:120761826-120761848 ATGGCTTGGGGCAGGGACAGGGG + Intronic
937335435 2:121059484-121059506 AGGGCTGGGGGGCGGCAGAGGGG + Intergenic
937986296 2:127639655-127639677 AGGGCTGTGGGGAGGCATAGAGG - Intronic
938104248 2:128519569-128519591 AGGACTGGTGGGAGGCAAGGGGG - Intergenic
938373156 2:130786591-130786613 AGGGCCTGGGCCAGGCACAGTGG + Intergenic
938777285 2:134553213-134553235 AGCGTGGGTGGGAGGCACAGAGG + Intronic
940106051 2:150101573-150101595 AGGGTTTGAGGCATGCACAGTGG + Intergenic
941723460 2:168836792-168836814 AGGGCCTCTGGGAGGCAGAATGG - Intronic
941806003 2:169712818-169712840 AGGCAATGTGGGAAGCACAGTGG + Intronic
942596399 2:177595267-177595289 AGGGAGGGAGGGAGGCACAGAGG + Intergenic
943090609 2:183370128-183370150 GCAGCTTGTGGGAGGCCCAGAGG + Intergenic
944665500 2:201955820-201955842 AAGATGTGTGGGAGGCACAGAGG + Intergenic
946056808 2:216909985-216910007 AGGGATGGTGGGAGGCAGACTGG - Intergenic
946309198 2:218873366-218873388 ACGGCCTGCGGGAGGCAGAGGGG - Exonic
946385325 2:219380964-219380986 AGGGTGTGTAGGAGACACAGGGG + Intronic
947133592 2:226954927-226954949 AGGGGTGGGGGCAGGCACAGTGG + Intronic
947627055 2:231626350-231626372 AGGACTGGTGGGATGCTCAGGGG - Intergenic
948004912 2:234600166-234600188 GGGGGGTGAGGGAGGCACAGAGG - Intergenic
948186360 2:236024461-236024483 AGGGAAGGAGGGAGGCACAGAGG - Intronic
948928334 2:241114685-241114707 AAGGCATGTGTGCGGCACAGCGG - Intronic
949035989 2:241815977-241815999 GGGGCTGGAGGAAGGCACAGGGG - Intronic
949083435 2:242124229-242124251 AGGGTTTTTTGGGGGCACAGAGG + Intergenic
1168803854 20:661815-661837 AGGGATGGTGGGAGGGAGAGGGG - Exonic
1168949283 20:1785525-1785547 AGGGGCTGTGTGAGGCACTGAGG - Intergenic
1169306214 20:4492675-4492697 AGGGCTTGAGGGAGAAACACGGG + Intergenic
1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG + Intronic
1171204278 20:23266948-23266970 AGGGGCGGTGGGAGGCAGAGAGG + Intergenic
1171279229 20:23882143-23882165 AGGGAAGGTGGGAGCCACAGAGG - Intergenic
1171487360 20:25494457-25494479 AGGGCATGTGGGATGCAATGAGG - Intronic
1172448122 20:35003644-35003666 GGGGCTGGTGGGAGCCCCAGTGG + Intronic
1172502313 20:35436313-35436335 AGGGGGCGGGGGAGGCACAGAGG - Intronic
1173075070 20:39810664-39810686 AGGGGTTTAGGGAGGCACATTGG - Intergenic
1173401616 20:42731040-42731062 AAGGGTGGTGGGGGGCACAGAGG - Intronic
1173461546 20:43247108-43247130 AAAACTTGTGCGAGGCACAGGGG - Intergenic
1173866686 20:46317034-46317056 AGGGAGGGAGGGAGGCACAGGGG - Intergenic
1174226522 20:49005260-49005282 AGGGCTTCTGGGAGCCCCAACGG - Intronic
1174722417 20:52827268-52827290 TGGGCTTGGGGGAAGTACAGTGG + Intergenic
1175129861 20:56781058-56781080 AGGGCTGCTGGGAGGCTCAAAGG - Intergenic
1175730151 20:61348975-61348997 AGGGCTTCTGGGAATAACAGTGG + Intronic
1175824578 20:61930096-61930118 AGGGGCTCTGGGAGGCAGAGTGG - Intronic
1175828758 20:61950945-61950967 AGGGCTGGTGGGAGGGAGGGTGG - Intergenic
1175957141 20:62617143-62617165 TGGGGTTCCGGGAGGCACAGAGG - Intergenic
1175968710 20:62673158-62673180 GGGGCATGGGGGGGGCACAGAGG + Intronic
1176090208 20:63315246-63315268 AGGCCTTGTGGGTGGCAGATGGG + Intronic
1176280029 20:64296853-64296875 AGGGTTTTTTGGGGGCACAGAGG + Intergenic
1178256533 21:31057619-31057641 ATGGATGGTGGGAGGCAAAGAGG + Intergenic
1178484574 21:33010547-33010569 AGGGCTGAAGGGAGGCACAAGGG - Intergenic
1178851664 21:36217378-36217400 TGGGGTTGTTGGAGGGACAGAGG - Intronic
1179128267 21:38611565-38611587 AGGGCCTGTGGGAGGCGAAGGGG - Intronic
1179513398 21:41890014-41890036 AGGGGAAGTGGGTGGCACAGAGG - Intronic
1180059337 21:45376552-45376574 GGGGCTTGTCAGAGTCACAGGGG - Intergenic
1180198983 21:46213579-46213601 AGGGCTTGTGGAAGCCACTGAGG - Intronic
1180230135 21:46422167-46422189 AGGGCTTGGGGGATGCCCCGAGG - Intronic
1180338504 22:11599977-11599999 AGGGATGGAGGGAGGGACAGAGG - Intergenic
1181036091 22:20170333-20170355 AGGGCTGATGGGAGGCTCAAGGG + Intergenic
1181039269 22:20184281-20184303 AGGGCCTGTGGGATGCATGGGGG - Intergenic
1181581775 22:23832681-23832703 ACTGCATGTGGGAGGCACACGGG + Intronic
1182808451 22:33095730-33095752 AGGTCCTGTGGTAGGCACGGAGG + Intergenic
1183269388 22:36851154-36851176 AGGGTTTGTGGGAGGAAGGGAGG - Intergenic
1183429874 22:37759088-37759110 AGGGCTGGTGGAAGGCAGTGAGG - Intronic
1183598125 22:38824446-38824468 AGGGCATATGGGAGGTACAGAGG + Intronic
1184112429 22:42403138-42403160 TGGGGTTGTAGAAGGCACAGAGG - Intronic
1184207908 22:43016738-43016760 AGGTATTGTGGGTGGCAAAGAGG - Intergenic
1184222397 22:43109636-43109658 TGGGCTGTTGGGAGGAACAGAGG - Intergenic
1184236248 22:43184672-43184694 AGGGCTGGGGGGAGGCTCAGAGG + Intronic
1185015585 22:48340827-48340849 AGGGCTCGTGGTGGGCTCAGCGG + Intergenic
1185035579 22:48475045-48475067 CCGGCCTGTGGGAGGCAGAGGGG - Intergenic
1185161425 22:49232236-49232258 AGCGGTCATGGGAGGCACAGAGG + Intergenic
1185285104 22:49996574-49996596 TGGGCGTGCGGGAGGCCCAGCGG + Exonic
949782838 3:7709546-7709568 AGGGGATGTGGGTGGCTCAGTGG + Intronic
950440704 3:13008637-13008659 GGGGGTTGGGGGAGGCAGAGAGG - Intronic
950610947 3:14126114-14126136 AAGGGGTGTGGGAGGCAGAGAGG - Intronic
952068971 3:29609651-29609673 AGGCCTTTTGCCAGGCACAGAGG - Intronic
952283555 3:31946570-31946592 AGCAATTGCGGGAGGCACAGCGG + Intronic
952435550 3:33269490-33269512 AGGGCTTGTTGCAGCCACTGTGG + Intergenic
953473703 3:43188213-43188235 AGGGTTTGTGGGAGACACAGAGG + Intergenic
953475985 3:43206166-43206188 AGGGCTTGGAGAGGGCACAGAGG + Intergenic
954131867 3:48565005-48565027 AGGGTTTGTGGGAATCAGAGAGG + Intronic
954584471 3:51721282-51721304 GGGGGTTATGGGAGGCAGAGGGG + Intergenic
954799465 3:53178813-53178835 AGGGCCTGTGCGGGGCACTGAGG + Intronic
955528578 3:59848116-59848138 ATGGCTTGTGGGAGCCACGGTGG - Intronic
955909216 3:63843072-63843094 AGGGGTTGGGGCAGGCACAGAGG - Intronic
958718800 3:97820940-97820962 AGGGCTTCTGGGAGGCAGCGTGG + Intergenic
959162902 3:102741258-102741280 AGGAAATGTGGGAAGCACAGTGG - Intergenic
960585236 3:119315004-119315026 AGGGCTTGGGGGAGGCACAAGGG - Intronic
960747765 3:120908618-120908640 TGGGCCTGGGGGAGGGACAGCGG + Intronic
961074021 3:123964819-123964841 AGGGATTGTGCTAGGCACTGGGG - Intergenic
961324612 3:126102879-126102901 TGGGCCTGTGGGAGGGACAGAGG + Intergenic
961742134 3:129039593-129039615 AGGGCTGGGGAGGGGCACAGCGG + Intronic
962207524 3:133447231-133447253 ATGACTTGTGTTAGGCACAGAGG - Intronic
962342525 3:134597332-134597354 ATGGTTTGTGGAAGGGACAGCGG - Intergenic
962567784 3:136680503-136680525 AGAATTTTTGGGAGGCACAGGGG + Intronic
964710849 3:159669825-159669847 AGGGCTTGTGGGCAGAACACAGG - Intronic
965087229 3:164114105-164114127 AGGGCTTTTGTGAGCCTCAGAGG - Intergenic
965310170 3:167116743-167116765 AGGGGTTGTGGGAGTGGCAGTGG - Intergenic
967378797 3:188834660-188834682 AGGCCTTGTGCTAGGCACTGAGG - Intronic
967817910 3:193814849-193814871 AGGGCATGGGAGAGCCACAGTGG - Intergenic
968238790 3:197055962-197055984 AGGGTTTGTGGGAGCCAGTGTGG - Intronic
968372207 3:198230148-198230170 AGGGTTTTTTGGGGGCACAGAGG + Intergenic
968449031 4:666512-666534 TAGGCTGGTGGGAGGAACAGAGG - Exonic
968451552 4:678428-678450 AGGGACTGGGGGAGGGACAGTGG - Intronic
968499161 4:938214-938236 AGGGCTGGGGCCAGGCACAGTGG + Intronic
968653500 4:1769118-1769140 TGGGCATGTGGGGGGCAGAGGGG - Intergenic
968915674 4:3496157-3496179 GGCGCTTGCGGGAGGGACAGCGG - Intronic
968935621 4:3608669-3608691 AGGGCTTCCTGGAGGCACTGGGG + Intergenic
969008908 4:4044750-4044772 GGTGCATGTCGGAGGCACAGAGG + Intergenic
969044918 4:4329736-4329758 AGGGCTGCTGTGAGGAACAGAGG + Intergenic
969089642 4:4684254-4684276 AGGCCCTGTGGTAGGCACTGGGG + Intergenic
970697212 4:18692089-18692111 AGGGCTTGTGGCATGCAGTGGGG + Intergenic
973777221 4:54254777-54254799 AGGGCTGGTGTTAGGCACAGTGG - Intronic
973895652 4:55410075-55410097 AAGGCTGGTGGGAGGCAAGGAGG - Intronic
974402482 4:61424926-61424948 AGGCAATGTGGGAAGCACAGTGG + Intronic
974778553 4:66521309-66521331 AGGGCTTGAGAGAGACAAAGTGG + Intergenic
974998912 4:69196427-69196449 GGTGCATGTGTGAGGCACAGGGG - Intronic
975776520 4:77793486-77793508 ATGGTTAGTGGGTGGCACAGTGG + Intronic
975915399 4:79319213-79319235 AGGGCTTGGGGTGGGCACAGCGG - Intronic
976405344 4:84656144-84656166 AGCGCTTGAAGGGGGCACAGAGG + Intergenic
977842866 4:101730147-101730169 AGGGCATATGGAAGGCCCAGAGG - Intronic
978403548 4:108356089-108356111 AGGGAGTGGGGGAGGCAAAGTGG + Intergenic
978760114 4:112348359-112348381 ATGGCTTGTGCAAAGCACAGAGG - Intronic
979260892 4:118642628-118642650 AGGGTTTTTTGGGGGCACAGGGG + Intergenic
981215261 4:142158051-142158073 AGGCTATGTGAGAGGCACAGAGG - Intronic
981505842 4:145498943-145498965 ACGGCTTGAGAGAGCCACAGGGG - Intronic
984596825 4:181678413-181678435 AGGTCTTGAGGGAGGCAACGGGG + Intergenic
984955679 4:185043270-185043292 AGGGCTTGTGCAAGCCACACGGG + Intergenic
986307925 5:6529231-6529253 TGGTGTGGTGGGAGGCACAGGGG - Intergenic
986681704 5:10239228-10239250 TGGGCTTGTGGGTGGCACCCTGG - Exonic
987073524 5:14359662-14359684 AGGGGGTGTGGGAGGGAGAGAGG + Intronic
987091210 5:14509160-14509182 ACGGCTTGGGGCAGGAACAGGGG - Exonic
987569659 5:19639551-19639573 AGTGGTTGTGGGAGGGACAAGGG - Intronic
990785449 5:59413561-59413583 AGGGATTGTGGGAGGGAGAAAGG - Intronic
991057078 5:62333378-62333400 AGGTGTTGAGGGAGGAACAGTGG + Intronic
991444512 5:66684858-66684880 AGCGCTTGTGGGAGGTAAAAGGG + Intronic
992432784 5:76726028-76726050 TGGGCTTTTGTGATGCACAGAGG - Intronic
992502870 5:77359085-77359107 AGGGACTGTGGGAGGCTCTGAGG + Intronic
994708343 5:103233684-103233706 AGGGCATGTGGAAAGAACAGTGG + Intergenic
995034441 5:107516977-107516999 AGGGCTGGGGGTAGGCACAGGGG + Intronic
996023604 5:118618954-118618976 AGGGCTGGTGGAAGGCAGAAAGG - Intergenic
996166147 5:120226428-120226450 AGGGATGGAGGGAGGCAGAGAGG - Intergenic
996382201 5:122873557-122873579 AGGGCTGGGTGAAGGCACAGAGG + Intronic
996393106 5:122985241-122985263 AGAGCTTGAGAGAGGCACTGTGG + Intronic
996961278 5:129253373-129253395 GGGGCCTGTTGGAGGCAGAGGGG - Intergenic
997241920 5:132314044-132314066 AGGGCTTAAGAGAGGCACAGAGG + Intronic
997419512 5:133755011-133755033 AGGCCATGTGGGAGGCAATGAGG - Intergenic
998483248 5:142480233-142480255 GGGGGTTGTGGTAGGCTCAGAGG + Intergenic
1002203057 5:177542206-177542228 AGTACTTGTGGAAGGCACTGGGG + Intronic
1002358214 5:178648255-178648277 GGTGCTGGTGAGAGGCACAGGGG + Intergenic
1002452293 5:179325847-179325869 ATGGCCTGTGGGAGGGACAGGGG + Intronic
1002698186 5:181104095-181104117 TGGGCTTGGGGGTGGCACAGCGG - Intergenic
1002709044 5:181183155-181183177 TGGGCTTGGGGGTGGCACAGCGG + Intergenic
1002753092 6:138392-138414 AGGGCTTTTTGGGGGCACAGAGG - Intergenic
1004181193 6:13381779-13381801 AGGGCTTGGGGGAGGAGGAGGGG - Intronic
1004352042 6:14898501-14898523 AGGGGTTGGGCTAGGCACAGTGG + Intergenic
1004791961 6:19036445-19036467 AGGGCTTTTGGAAGGGAGAGTGG + Intergenic
1005454420 6:26005537-26005559 AGGGCTAATGGGAAGAACAGGGG + Intergenic
1006408545 6:33858749-33858771 CGGGCATGCGGGAGGCACACTGG + Intergenic
1006641822 6:35493357-35493379 AGGGCGTGTAGGAGGCTCTGTGG - Intronic
1006909602 6:37555408-37555430 AGGGCAGCTGGGAAGCACAGAGG + Intergenic
1007359671 6:41345988-41346010 AGGGGCTGTGAGGGGCACAGAGG - Intronic
1007679578 6:43625082-43625104 AGGGCTGGCAGGAGGCACTGAGG - Intronic
1007806896 6:44457098-44457120 AGAGCTTTGGGGAGGCAGAGTGG + Intergenic
1007826205 6:44602701-44602723 AGGGCTCTGGGGAGGTACAGAGG + Intergenic
1010125384 6:72425866-72425888 AGGGCTTCTGGAAGGCACTAAGG + Intergenic
1011258432 6:85448104-85448126 AGGGAATGTGTGAGGAACAGTGG + Intergenic
1011612863 6:89170437-89170459 TGGGCTTCTGCCAGGCACAGTGG + Intergenic
1013611527 6:111800381-111800403 ACAGCTTGTGGGAGGCTCTGTGG + Intronic
1014297742 6:119641185-119641207 AGGTGCTGTGAGAGGCACAGAGG + Intergenic
1016730249 6:147420786-147420808 GGTGCTTTTAGGAGGCACAGAGG - Intergenic
1016816913 6:148311390-148311412 AGGTGTGGTGGCAGGCACAGTGG - Intronic
1017621048 6:156297839-156297861 AGTTCTTGTGCCAGGCACAGTGG + Intergenic
1017770738 6:157642580-157642602 AGGGGTTGTGGGGGAGACAGAGG + Intronic
1018029495 6:159830833-159830855 TGGGTTTGTGGAGGGCACAGAGG + Intergenic
1019051444 6:169186708-169186730 AGGGTTTGTTGATGGCACAGTGG - Intergenic
1019112239 6:169724925-169724947 GGAGCGTGCGGGAGGCACAGCGG + Intronic
1019514587 7:1434157-1434179 TGGGCTGGTGGGAGCCTCAGAGG - Intronic
1020027768 7:4911203-4911225 AGCGCATGTGGGAGGCCCAGGGG + Exonic
1020085560 7:5308337-5308359 ATGGCAGGTGGGGGGCACAGAGG + Intronic
1020100256 7:5390448-5390470 CGGGGTTGGGGGTGGCACAGGGG - Intronic
1023162418 7:37310020-37310042 AGGGATTCTGGGAGGTTCAGGGG + Intronic
1023324754 7:39042063-39042085 AGAGCATGTGGGAGGAACAGAGG + Intronic
1023669637 7:42561912-42561934 AGGGCTTGTTGTAGCCACAGTGG - Intergenic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1025015843 7:55438644-55438666 AGGCCTTGGAGAAGGCACAGAGG + Intronic
1025211726 7:57023146-57023168 ATGCCAGGTGGGAGGCACAGAGG - Intergenic
1025660229 7:63553680-63553702 ATGCCAGGTGGGAGGCACAGAGG + Intergenic
1025682203 7:63689508-63689530 AGGGCTTGGGCGAGGCATGGTGG - Intergenic
1026146028 7:67747491-67747513 AATGCTTGAGGTAGGCACAGTGG - Intergenic
1026509992 7:71019647-71019669 GGGCCTAGAGGGAGGCACAGTGG + Intergenic
1027251937 7:76404333-76404355 AGGGCTTGGGGGAGGAAGGGAGG + Exonic
1028802010 7:94977102-94977124 GGGGCTTGTGGGAGTAAGAGGGG + Intronic
1029082888 7:97988795-97988817 AGGGGGAGGGGGAGGCACAGAGG - Intronic
1029098906 7:98111618-98111640 AAGGGTTGTGGGGGGCACAGTGG + Intronic
1029262771 7:99314606-99314628 AGGGCTTGTGGGAAGAAGAGTGG + Intergenic
1029433320 7:100546593-100546615 AGGCATTATGGGAGGCACTGTGG - Intronic
1029537598 7:101165342-101165364 AGGGTTTGAGGGACGAACAGCGG + Intronic
1029974007 7:104815710-104815732 TGGGGTGGTGGTAGGCACAGGGG - Intronic
1030512433 7:110500165-110500187 AGGGCTGGTAGGAGATACAGAGG - Intergenic
1033384284 7:140856250-140856272 TGGGGTTGGGGGAGGAACAGAGG + Intronic
1033923601 7:146427894-146427916 AGTGCCTGTTGGAGGTACAGGGG - Intronic
1034400256 7:150857310-150857332 GGGGCTTGTGGGAGGAGAAGAGG - Exonic
1034963304 7:155375389-155375411 AGGCCTGGTGGAAGGGACAGGGG - Intergenic
1035010125 7:155708048-155708070 ACGGCATGTGGTAGACACAGTGG - Intronic
1035512066 8:198584-198606 AGGGTTTTTTGGGGGCACAGAGG - Intronic
1035596976 8:866161-866183 AGGGTATGTGAGAGGCACCGAGG - Intergenic
1038575553 8:28701313-28701335 GGGGATTGTGGGAGGCGCGGGGG - Exonic
1038860222 8:31379666-31379688 AGGGCTGGGGGTAGGGACAGTGG + Intergenic
1041958374 8:63582744-63582766 GGGGTTTGGGGGAGGCACTGAGG + Intergenic
1043482012 8:80663508-80663530 AGGGTTGGTGGGGGGCACAGAGG + Intronic
1044243125 8:89910522-89910544 CTGGCTTGTGGGAGGAAAAGAGG + Intronic
1045214378 8:100131836-100131858 AGGGCTTAGGTCAGGCACAGTGG + Intergenic
1045343407 8:101273768-101273790 AAGGCTTGTGGGTGGCCCAGGGG - Intergenic
1049283774 8:141763617-141763639 ATGGGTGGTGGGAGGGACAGAGG - Intergenic
1049378588 8:142301148-142301170 AGGGCAAGTGGGGGGCACTGTGG - Intronic
1049378612 8:142301215-142301237 AGGGCAGGTGGGGGGCACTGTGG - Intronic
1049378680 8:142301406-142301428 AGGGCAGGTGGGGGGCACTGTGG - Intronic
1049378727 8:142301535-142301557 AGGGCAGGTGGGGGGCACTGTGG - Intronic
1049833535 8:144717991-144718013 AGGGCTTGTGGGTGGCTCTAAGG - Intergenic
1051228199 9:14925007-14925029 GGGACTGGTGGGAGGCAGAGAGG + Intergenic
1053084306 9:35204936-35204958 GAGATTTGTGGGAGGCACAGAGG - Intronic
1053313284 9:37032847-37032869 CAGGCCTGTGGGAGGCACATGGG + Intronic
1054454563 9:65423202-65423224 AGGGCTTCCTGGAGGCACTGGGG - Intergenic
1055156293 9:73066847-73066869 AGTGCTGTTGGGGGGCACAGTGG + Intronic
1055695945 9:78884507-78884529 AGGGATTGGGCCAGGCACAGTGG - Intergenic
1055928986 9:81540345-81540367 AGGCACTGTGGGAGGCACTGGGG - Intergenic
1056082109 9:83106349-83106371 AGGGGTGATGGGAAGCACAGAGG - Intergenic
1056215292 9:84400649-84400671 AGGGTTGGTAGGAGGCACTGTGG + Intergenic
1056277304 9:85006005-85006027 AGGCATTGTCGTAGGCACAGGGG - Intronic
1056740002 9:89246250-89246272 AGAGTTCCTGGGAGGCACAGTGG - Intergenic
1057047596 9:91898070-91898092 CAGGCTTGTGGGAGTCAGAGAGG - Intronic
1057200029 9:93134813-93134835 AGGGGCTGGGGGAGGCACAAAGG + Intergenic
1057216262 9:93230490-93230512 AGGGCCTGTGAGAACCACAGGGG - Intronic
1058567363 9:106300686-106300708 AGGGGTAATGGGAGGTACAGTGG - Intergenic
1059307709 9:113367757-113367779 AAGGCTTCTGGGGGGCACAGGGG + Intronic
1059742003 9:117160845-117160867 AGGTTTTGTGAGAGACACAGTGG + Intronic
1060045460 9:120336850-120336872 ATGTCCTGTGGGAGGCACTGGGG - Intergenic
1060985793 9:127818293-127818315 GGGGCCTGAGGGAGGCACCGTGG - Exonic
1061059362 9:128242991-128243013 TGGGCCTGTGGGGGCCACAGAGG - Intronic
1061135451 9:128730794-128730816 AAGGCTTTTGGGAGACCCAGTGG + Exonic
1061396341 9:130345909-130345931 ATGGCATGTGGAAGGCACACTGG - Intronic
1061692017 9:132340943-132340965 AGTGCCTGTGGGAGGCACTATGG - Intronic
1061744889 9:132732461-132732483 TGGGCCTGAGGGAGGCCCAGAGG + Intronic
1061762954 9:132863124-132863146 AGCGTGTGTGGGAGGGACAGGGG + Intronic
1061997195 9:134192566-134192588 TGGGCTGGTGGGGGACACAGCGG + Intergenic
1062091175 9:134679523-134679545 AGGGCTGGTTGGGGGCACTGCGG + Intronic
1062216678 9:135393119-135393141 AGGGCTTGAGGCAGGCAAGGTGG - Intergenic
1062280224 9:135748581-135748603 AGGGGTTGAGGCAGGAACAGGGG + Intronic
1062519099 9:136950254-136950276 AGGGGACGTGGGGGGCACAGAGG + Intronic
1062683498 9:137797914-137797936 AAGGCGTGTGGATGGCACAGCGG + Intronic
1062728819 9:138096982-138097004 AGGGCTTGTGGGAGGGTGTGTGG + Intronic
1062755853 9:138288202-138288224 AGGGTTTTTTGGGGGCACAGAGG + Intergenic
1185704264 X:2254928-2254950 GGGGCGTGGGGCAGGCACAGTGG - Intronic
1186467842 X:9797788-9797810 GGGGCTGGCCGGAGGCACAGTGG + Intronic
1189206272 X:39241801-39241823 AGGTATGGTGGGGGGCACAGAGG + Intergenic
1190100964 X:47522872-47522894 AGGGCTTGAGGAGGGCACCGGGG - Intergenic
1190222708 X:48522531-48522553 AAGTCTGGTGGGAGGCACATGGG - Intronic
1191845600 X:65545377-65545399 AAGGCTTGAGGCAGGCTCAGAGG - Intergenic
1193255377 X:79342527-79342549 AGGGCTAGTGGCAGCCACTGTGG - Intergenic
1193508503 X:82371741-82371763 TGGGGTTGTGGCAGGAACAGAGG + Intergenic
1194231545 X:91331230-91331252 AGTGCTGTTGGGAGGCACAGTGG + Intergenic
1195512380 X:105731801-105731823 GGGGCTTGGGGGAGGAAGAGAGG + Intronic
1195738965 X:108042964-108042986 AGGGTTTCTGGGAGGAATAGAGG + Intergenic
1195927455 X:110039909-110039931 AGGGGTTGGGGGTGGCTCAGAGG + Intronic
1198033601 X:132779774-132779796 AGGGTTATTGGGAGGAACAGGGG - Intronic
1198130006 X:133684320-133684342 AAGGCTGGTGGGAGGGACAGAGG - Intronic
1198951550 X:142077983-142078005 AGGGCTTGAATGAGCCACAGTGG + Intergenic
1200135902 X:153874553-153874575 AGGGCTTGGAGGAGGTAAAGGGG - Intronic
1200212835 X:154354499-154354521 AGGGCATGGGTGAGGGACAGTGG + Intronic
1201305105 Y:12543057-12543079 AGGCCTTCTGGAAGGAACAGAGG + Intergenic
1201777796 Y:17685518-17685540 GGTGCATGTTGGAGGCACAGAGG - Intergenic
1201823762 Y:18220474-18220496 GGTGCATGTTGGAGGCACAGAGG + Intergenic
1202148239 Y:21822233-21822255 AGTGCTGTTGGGGGGCACAGTGG - Intergenic
1202355349 Y:24042486-24042508 AGGGATTCTGGGAGACACATTGG - Intergenic
1202515429 Y:25627623-25627645 AGGGATTCTGGGAGACACATTGG + Intergenic