ID: 1076526429

View in Genome Browser
Species Human (GRCh38)
Location 10:131115265-131115287
Sequence GCCCTGCCCCGAGGGGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 7, 3: 51, 4: 439}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076526429_1076526434 12 Left 1076526429 10:131115265-131115287 CCTGGAGCCCCTCGGGGCAGGGC 0: 1
1: 0
2: 7
3: 51
4: 439
Right 1076526434 10:131115300-131115322 CCACTCTGCAGAGACCAAGTTGG No data
1076526429_1076526435 13 Left 1076526429 10:131115265-131115287 CCTGGAGCCCCTCGGGGCAGGGC 0: 1
1: 0
2: 7
3: 51
4: 439
Right 1076526435 10:131115301-131115323 CACTCTGCAGAGACCAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076526429 Original CRISPR GCCCTGCCCCGAGGGGCTCC AGG (reversed) Intronic
900178784 1:1302390-1302412 GCCCAGCCCCTGGGTGCTCCCGG - Intronic
900373947 1:2344763-2344785 GCCCTGCCCCCAGGCTCTGCAGG - Intronic
900381628 1:2387074-2387096 GCCCTGCAGGGAGGGGCTTCTGG - Intronic
900399429 1:2467015-2467037 GCCCTTCCCAGAGGCCCTCCTGG + Intronic
900408806 1:2503792-2503814 GCCCTGTGCCGAGGGTCGCCAGG - Intronic
900417253 1:2540774-2540796 GCCCTGCCCCGGGGCGCACGGGG - Intergenic
900475700 1:2875417-2875439 GCCCATCCTCCAGGGGCTCCTGG - Intergenic
900512615 1:3067754-3067776 GCGCCGCCCCGCGAGGCTCCTGG - Intergenic
900600811 1:3501978-3502000 GCCTTTCCCCCAGGGGCTCCTGG + Intronic
900607772 1:3531398-3531420 GCCCGGCCCAGAGCGGCTCCCGG - Intronic
900646019 1:3709045-3709067 GCCCTGCCCCTCGGCCCTCCAGG - Intronic
900646550 1:3711418-3711440 TCTCTGCCCCGAGGGCCTCCTGG - Intronic
900894032 1:5470418-5470440 GCCCTGCCCCCAGAGACACCTGG - Intergenic
900993668 1:6109100-6109122 GCCCAGCCCAGAGGGGCTCCTGG - Intronic
901011760 1:6206347-6206369 TCCCTGCGCCGGGGAGCTCCAGG + Intronic
901810627 1:11765262-11765284 GCCCTGCGCCCAGAGCCTCCCGG + Intronic
902561612 1:17281000-17281022 GCCCTGGCCCAAGGGGCATCAGG + Intronic
903127485 1:21257785-21257807 GCCCCCCCCCGCAGGGCTCCTGG + Intronic
903281296 1:22251422-22251444 GCCTTGGCCCGGGGGACTCCAGG - Intergenic
903568236 1:24285016-24285038 GCCCTCCCCCATGGGGCTCCTGG - Intergenic
903788362 1:25875798-25875820 GCTCTGCGCCGAGGAGCCCCGGG - Intergenic
904321972 1:29703717-29703739 GCTTTGCCACTAGGGGCTCCAGG - Intergenic
904475409 1:30761862-30761884 GTCTTCTCCCGAGGGGCTCCTGG + Intergenic
904697630 1:32339179-32339201 GCCCTGGCCTGAGATGCTCCCGG + Intergenic
905653551 1:39671990-39672012 GCCCGGGCTCGCGGGGCTCCTGG + Exonic
905731353 1:40301268-40301290 GCCAGGCCCCGTGGGGCTGCCGG - Exonic
906201894 1:43965907-43965929 GGCCTGCCCCGAGTGGTACCAGG - Intronic
906263137 1:44407836-44407858 GCCCCGCCCCGGGGGTCACCCGG - Intronic
906607641 1:47182949-47182971 GCCCAGCACGGAGGGGCTACTGG + Intergenic
906954190 1:50358893-50358915 CCCCTGCCCCGTGTGGCTCTCGG - Intergenic
907308745 1:53527688-53527710 GGCCTGACCCGAGGGGCCTCTGG + Intronic
908600053 1:65728770-65728792 GCCCTGCCTAACGGGGCTCCAGG - Intergenic
910208994 1:84775004-84775026 GGCCTGCCCTGAGGGTCTGCAGG + Intergenic
912682677 1:111739128-111739150 GCTCCGCCCCGACGGGCACCTGG - Intronic
913521440 1:119648487-119648509 GCCCCGCCCCGCGGCGCTCAAGG + Intergenic
915345211 1:155193660-155193682 GCCCAGCCCCGCAAGGCTCCCGG - Intergenic
915908619 1:159898575-159898597 CCCCTGCCCTGAGTGGCTCCTGG + Intronic
918159332 1:181882747-181882769 GCCCTGCCCCCAGAGGCAGCAGG - Intergenic
919923042 1:202177586-202177608 CCCCTGCCCCAAGGGGCTGCTGG - Intergenic
919926397 1:202193992-202194014 GCCCAGCCCGCCGGGGCTCCGGG + Exonic
921051531 1:211515171-211515193 CCCCTGCCCCGGGAGCCTCCAGG - Intergenic
922547657 1:226470796-226470818 GCCCTGCCCCATGGGGCTGGTGG + Intergenic
922728551 1:227937992-227938014 GCCCTGCCCTGGGGGCCACCTGG + Intronic
922744708 1:228037478-228037500 GACCACCCCCGAGGGGCTCCTGG - Intronic
923353224 1:233129395-233129417 GCCCCGCCGCGGTGGGCTCCTGG + Intronic
923560343 1:235035309-235035331 GGCCTGCCCTCAAGGGCTCCCGG + Intergenic
924623754 1:245684168-245684190 GCCCTGCCCTGAGGGCCACAGGG + Intronic
1062949519 10:1487491-1487513 GCCCTGCCCTGACCTGCTCCCGG + Intronic
1063036465 10:2290842-2290864 GCACTGCCCCGGGCGTCTCCAGG - Intergenic
1063036498 10:2290980-2291002 GCACTGCCCCGGGCGTCTCCAGG - Intergenic
1063125748 10:3135525-3135547 GGACTGCCCCGAGGGCTTCCTGG - Intronic
1063366883 10:5496439-5496461 GCTCTGCCCGGAGGTCCTCCAGG - Intergenic
1066746098 10:38604926-38604948 GCTGTGGCCTGAGGGGCTCCTGG - Intergenic
1067038531 10:42935951-42935973 GCCCCACCCTGAGGGGCTCGGGG + Intergenic
1067180568 10:43982873-43982895 GCCCTTCCCAGGGGGGCTTCTGG - Intergenic
1069917596 10:71797030-71797052 GCCCTTCCCAGGGGTGCTCCTGG - Intronic
1070325892 10:75388815-75388837 GACATGCCCTGAGGGGCTCTGGG - Intergenic
1070334193 10:75439927-75439949 GACCAGCCCCCAGGGGCTCAGGG + Intronic
1071529354 10:86377201-86377223 GCCCTGCCCCAAGAGACCCCGGG + Intergenic
1073136840 10:101224880-101224902 GCCCAGCCCCCCGCGGCTCCCGG - Intergenic
1075088797 10:119431321-119431343 GGCCTGCCCCGAGCTCCTCCAGG - Intronic
1075871373 10:125774296-125774318 GCCCAGTCCCGAGGGGCCGCCGG - Exonic
1076301758 10:129433615-129433637 GCCCAGCCCCGAGAGGCTGCAGG - Intergenic
1076456677 10:130604840-130604862 TCCCTGCCCTGTGGAGCTCCTGG + Intergenic
1076526429 10:131115265-131115287 GCCCTGCCCCGAGGGGCTCCAGG - Intronic
1076536104 10:131178707-131178729 GCCCTGCCCCAGGTGTCTCCGGG + Intronic
1076581288 10:131513612-131513634 GTCATGCCCCGAGGGGCTCCAGG + Intergenic
1077054559 11:584625-584647 GCTCAGCCCTCAGGGGCTCCAGG - Intronic
1077177802 11:1198510-1198532 GCCTGGCTCCGGGGGGCTCCGGG + Intronic
1077216816 11:1398469-1398491 GCCCTGCCCCCTGGGGATACAGG + Intronic
1077227072 11:1443118-1443140 CGCCTGCCCCGAGGTGATCCGGG + Exonic
1077300807 11:1846133-1846155 GGCCTCCACCGAGGGGCCCCCGG + Intergenic
1077402389 11:2365680-2365702 ACCCAGCACCGAGGGGCTCATGG + Intergenic
1077419895 11:2445159-2445181 GCGCTGCCCCGCCGGGCGCCTGG - Exonic
1077480564 11:2812575-2812597 GCCCCGTCCCCAGGGGCTCCCGG + Intronic
1078377714 11:10809466-10809488 GCGCTGCGCCCGGGGGCTCCAGG - Intergenic
1079588123 11:22150457-22150479 GCCTTGCCCCGTGCTGCTCCAGG + Intergenic
1080433826 11:32221774-32221796 GCGCTGCCCCCAGGGCCTTCTGG - Intergenic
1080640788 11:34157237-34157259 GCCTTGCCCCGTGGGTCTCCTGG - Intronic
1081567904 11:44270970-44270992 GCCCTGCTCCAGGGGGCTGCAGG - Intronic
1081754048 11:45532124-45532146 GGCCTCCCCCAAGAGGCTCCTGG + Intergenic
1081861036 11:46333395-46333417 GCCCTGGCCCGAGGGTTCCCGGG + Intronic
1082785269 11:57313224-57313246 GCCCAGACCCGAGGGCCTCGTGG + Exonic
1083678965 11:64342629-64342651 GCGCTGCCGCGAGCGGCTGCAGG + Exonic
1083861519 11:65422667-65422689 ACCCTGCCCGGAGAGACTCCCGG - Intergenic
1083883060 11:65557934-65557956 CCCGGGCCCCGAGGGGCTGCTGG - Exonic
1083995320 11:66268846-66268868 CCCCTCCCCCCAGGGGCCCCAGG + Intronic
1084212550 11:67630640-67630662 GTCCCTCCCCTAGGGGCTCCAGG + Intergenic
1084415891 11:69032816-69032838 GCCCAGTCCACAGGGGCTCCAGG + Intergenic
1084453353 11:69252841-69252863 GCCATGCCCCAAGGGGCTGCTGG - Intergenic
1084530892 11:69727152-69727174 GCCCTGTCCCCGGGAGCTCCTGG - Intergenic
1084961743 11:72720484-72720506 GGACTGGCCCTAGGGGCTCCCGG - Intronic
1084971259 11:72773343-72773365 GTCCTGCCTCCAGGGGCCCCAGG - Intronic
1085316407 11:75547878-75547900 TCTCTGCCCTGAGGGGCTCAGGG + Intergenic
1088923693 11:114280360-114280382 ACCCTTGCCCTAGGGGCTCCCGG - Intronic
1091145087 11:133272584-133272606 ACCCTGCCCCGAGCGTCCCCGGG - Intronic
1091237630 11:134032712-134032734 GCCCTGCCCCGTGGGGGCTCCGG + Intergenic
1091259544 11:134223826-134223848 GCCCTGGCCCCCGGGCCTCCCGG + Intronic
1091278828 11:134370516-134370538 TCCCTGTCTGGAGGGGCTCCAGG - Intronic
1091603440 12:1931289-1931311 GCCCTGCCCTGAGGAGATGCTGG - Intergenic
1094182374 12:27605353-27605375 TCCCTACCCCCAGGGGCTCCTGG - Intronic
1095542844 12:43330479-43330501 TCCCGGCCCCCAGTGGCTCCAGG - Intergenic
1095983155 12:47984043-47984065 CCCCTGCCCCCAGGGCCACCTGG + Intronic
1096777821 12:53974645-53974667 GCGCTGCCCCGCGGGCTTCCCGG + Intronic
1097342402 12:58454132-58454154 ACCCTCCCCAGAGTGGCTCCTGG + Intergenic
1097544169 12:60978150-60978172 GCACTGCCCCCAGAGGCTCCAGG + Intergenic
1097763412 12:63494916-63494938 GCACTTCCCCCAGAGGCTCCTGG + Intergenic
1099955830 12:89352074-89352096 TGCCTGCCCCGAGGGGCGTCTGG - Exonic
1100830999 12:98516286-98516308 CCCCTTCCCCGCGGGGCTGCAGG + Intronic
1101551591 12:105767531-105767553 GGCCTGGCCAGAGGGGCTCGGGG + Intergenic
1101605929 12:106247786-106247808 ACCCTTCTCCGAGGGGCTCGCGG + Exonic
1102228118 12:111243711-111243733 GCCCTGGACTGAGGGGTTCCCGG + Intronic
1102492899 12:113299478-113299500 GCCCTTCTCAGAGGGGCTCTGGG + Exonic
1102682153 12:114698232-114698254 GCCCTTCACAAAGGGGCTCCAGG + Intergenic
1102973552 12:117190156-117190178 GCCCGGCCCCGGGGGGCGCGGGG + Intronic
1103336629 12:120194772-120194794 GCCCTGCCCCCGCTGGCTCCCGG - Intergenic
1104485900 12:129150967-129150989 CCCCTGCCCTGAGTGGCTGCCGG + Intronic
1104811525 12:131622689-131622711 GCCCTGCCCCGGGAGGGTGCTGG - Intergenic
1104857475 12:131908842-131908864 GCCCGGCGGGGAGGGGCTCCGGG + Intronic
1105512246 13:21060990-21061012 CCCCTGCCCCGCCGGGATCCCGG + Intronic
1106720097 13:32427816-32427838 CCCCTGCCCCAAGCCGCTCCCGG - Intronic
1107959078 13:45543071-45543093 GTCCTGCTCCCAGGGGCCCCGGG + Intronic
1111657875 13:91175245-91175267 GCCCAGCCCCGAGGGGACGCTGG + Intergenic
1111975913 13:94967637-94967659 GCCCTGCTCCGAGGGACCCCCGG - Intergenic
1112197803 13:97242687-97242709 CCCCAACCCCGGGGGGCTCCCGG - Intronic
1113464488 13:110504013-110504035 GGGCAGCCCCGAGGGGCTCCAGG - Intronic
1113764091 13:112870029-112870051 GCCTTGCCCCCAGGGACACCTGG - Intronic
1113776321 13:112947696-112947718 GCCCTGCCCCCAGGGGTTGCTGG + Intronic
1113874238 13:113584744-113584766 GCCCTGGGCCGAGTGGCGCCGGG - Exonic
1114648025 14:24266508-24266530 TCCCTGCCCCCAGGTGCTGCAGG - Exonic
1117953770 14:61107348-61107370 GCCAAGCCCCGAGTGTCTCCTGG + Intergenic
1118363600 14:65076075-65076097 GCCCTGCCCAGGTGGCCTCCTGG - Exonic
1121447276 14:93987172-93987194 GCCCTGCCCTCAGGGCCTCTGGG + Intergenic
1121653460 14:95576824-95576846 CCCTGGCCCCCAGGGGCTCCAGG + Intergenic
1121928314 14:97949046-97949068 GCTCGGCCCCGGGGCGCTCCAGG + Intronic
1121974860 14:98393671-98393693 GCCCGGCCCTGAGGCTCTCCAGG - Intergenic
1122114735 14:99522045-99522067 GACCTGCCCGGAGGGGCACAAGG - Intronic
1122399597 14:101458881-101458903 GCCCTGCGCCCTGGGGCCCCGGG + Intergenic
1122494011 14:102139487-102139509 GCCCTGCCCTGAGGGGCGCCGGG - Exonic
1122719873 14:103716030-103716052 GCCCGGCCCCGCGGGCTTCCAGG + Intronic
1122775978 14:104117137-104117159 GCCCTGCCACGCGGGGCCCGCGG + Intergenic
1123060571 14:105592413-105592435 GCCCTGACCCGCAGGGCTGCAGG - Intergenic
1123500692 15:20878359-20878381 GCCCTGCCCGGCGGGGTACCTGG + Intergenic
1123557937 15:21452052-21452074 GCCCTGCCCGGCGGGGTACCTGG + Intergenic
1123594166 15:21889333-21889355 GCCCTGCCCGGCGGGGTACCTGG + Intergenic
1125766823 15:42141847-42141869 GACCTGCCTCGAGGTGCCCCAGG - Exonic
1127282045 15:57501160-57501182 GCCCTGCCCAGAAGGGCTCCTGG + Intronic
1128318481 15:66676392-66676414 TCTCTGCCCCAAGGAGCTCCTGG + Intronic
1129162216 15:73753158-73753180 GCCCTGCCCCGCCGGGCTCCCGG + Intergenic
1129296513 15:74603111-74603133 GGCCTGCCCTCAGGGGCTCCTGG - Intronic
1131121027 15:89823516-89823538 GCCCTGCCCTGGGGGACTCCTGG - Intergenic
1131998893 15:98160307-98160329 GCCCTCCCCTGAGGGCCTGCTGG - Intergenic
1202966288 15_KI270727v1_random:179224-179246 GCCCTGCCCGGCGGGGTACCTGG + Intergenic
1132471605 16:106918-106940 CCACAGCCCAGAGGGGCTCCTGG + Intronic
1132590886 16:726036-726058 GCGGTGCCCCCAGGAGCTCCTGG + Exonic
1132675271 16:1118796-1118818 GCCCTGGCCCCAGGGTCCCCAGG + Intergenic
1132766565 16:1537341-1537363 GCCCTGCCCCATGGGGCACATGG + Intronic
1132813012 16:1810689-1810711 GCTCTGCCCTGAGGCCCTCCTGG - Intronic
1132945281 16:2528807-2528829 GCTCTGCCCACAGGAGCTCCTGG + Intronic
1133020601 16:2965150-2965172 GCCCCGCCCCCAGGTTCTCCAGG - Intronic
1133346104 16:5071699-5071721 TCTTGGCCCCGAGGGGCTCCTGG + Intronic
1133771452 16:8869059-8869081 TCCCCGCCCCCAGGAGCTCCCGG + Intergenic
1133883602 16:9805807-9805829 GCCCTTCCCCGATGGGTACCCGG - Intronic
1135407139 16:22206582-22206604 GCCCTGCACCCTGGAGCTCCGGG + Exonic
1136122670 16:28149310-28149332 GCCCTGCCGCCAGCGCCTCCAGG - Intronic
1136377267 16:29872807-29872829 GCCCAGCCCCACCGGGCTCCCGG - Intronic
1136654312 16:31700793-31700815 GGCCTGCCCCTGGCGGCTCCGGG + Intergenic
1136736960 16:32474715-32474737 GCTGTGGCCTGAGGGGCTCCTGG + Intergenic
1139233079 16:65305810-65305832 GCCCTGCTCCCAGTGGCTGCTGG - Intergenic
1139956918 16:70697590-70697612 TCCCAGCCCCATGGGGCTCCGGG - Intronic
1140223015 16:73057952-73057974 GCCCCACCCCGAGAGGCGCCGGG - Intronic
1140280482 16:73550147-73550169 GCCCAGCCCCGAAGTACTCCTGG - Intergenic
1141262560 16:82467179-82467201 GCCCCACCCCAAGGAGCTCCTGG - Intergenic
1141679292 16:85535116-85535138 CCCCGGCCCCAAAGGGCTCCAGG + Intergenic
1141963698 16:87426643-87426665 GCCCTGCCCCCAGAGGTGCCTGG - Intronic
1142115380 16:88353549-88353571 TGCCTGCCCAGAGAGGCTCCCGG + Intergenic
1142201059 16:88761381-88761403 GCCCTGCCCAGGAGGGCACCAGG + Intronic
1142286219 16:89172540-89172562 GCCCAGCCCCCAGAGGCTGCTGG + Intronic
1142403566 16:89873712-89873734 CGCCGGGCCCGAGGGGCTCCTGG - Exonic
1203016111 16_KI270728v1_random:354862-354884 GCTGTGGCCTGAGGGGCTCCTGG - Intergenic
1203034446 16_KI270728v1_random:628020-628042 GCTGTGGCCTGAGGGGCTCCTGG - Intergenic
1142807601 17:2379697-2379719 GCCCTGATCCGAGGGCATCCTGG - Exonic
1143027129 17:3947549-3947571 GGCCATCCCCGAGGGCCTCCCGG - Exonic
1143872097 17:9964403-9964425 GGCCTGCCACGAGGAGCTCAGGG - Intronic
1144131663 17:12252586-12252608 GCACAGCCCTGAGTGGCTCCAGG + Intergenic
1145103595 17:20096878-20096900 TCCCTGCCCCGAGAGGCCACTGG - Intronic
1147123802 17:38352210-38352232 GGCCCGGCCCGCGGGGCTCCCGG + Intronic
1147159563 17:38562344-38562366 GACCAGCCCCGTGGGGTTCCGGG - Intronic
1147192840 17:38747627-38747649 GCCCTTCCCCGCCGGGGTCCGGG - Intronic
1147331246 17:39700538-39700560 TCCAGGCTCCGAGGGGCTCCGGG + Intronic
1147402691 17:40190642-40190664 GCCCCTCCCCGAGGAGATCCAGG + Exonic
1147741644 17:42673802-42673824 CCCCTCCTCCGCGGGGCTCCCGG + Exonic
1147845221 17:43399912-43399934 GCGATCCCCCGAGGGGCACCCGG - Exonic
1148079543 17:44960128-44960150 GCCCCGCCCGGAGGGGACCCCGG + Exonic
1148645596 17:49218165-49218187 GCCCTGCCCCTGTGGGCACCGGG + Intronic
1148782447 17:50129618-50129640 CCCCGGCCGCGGGGGGCTCCGGG + Exonic
1148786563 17:50148851-50148873 GCCCTGCCCCACGCGGGTCCTGG - Intronic
1149293346 17:55238361-55238383 GTCCTGCAGCTAGGGGCTCCTGG - Intergenic
1150228348 17:63535928-63535950 GTCCTGCACCGAGGGGCCCGAGG - Exonic
1150445220 17:65223431-65223453 GCCCTGCCCTCAGTGGCCCCTGG + Intronic
1150789941 17:68195832-68195854 CCCCTGCCCTCAGGGGCCCCAGG - Intergenic
1151233326 17:72700539-72700561 GCCCTGCCCCCAGGGTCCCCAGG + Intronic
1151274689 17:73025192-73025214 GTCCTGCCCAGACGGGCTCCAGG - Intronic
1151833744 17:76570215-76570237 GCCCAGCCGCCAGCGGCTCCGGG - Intronic
1151887144 17:76929793-76929815 GCTCTGCCCCCAGGAGCTCTTGG + Intronic
1152274783 17:79349856-79349878 TGCCTGCCCCGGGGGGCTCAGGG - Intronic
1152283355 17:79398269-79398291 GTCCAGCCCTGAGGCGCTCCTGG + Intronic
1152305228 17:79516492-79516514 GTCCAGCCCAGAGGGGCTCCAGG + Intergenic
1152377561 17:79926636-79926658 GCCCTTCCCCGAGGGACTCCCGG + Intergenic
1152407204 17:80104604-80104626 GCCCTGCTCCCACCGGCTCCTGG + Intergenic
1154254527 18:12770944-12770966 GCACTCCCGCGAGGAGCTCCAGG + Intergenic
1154303275 18:13213275-13213297 GCCCTGTCCTCAAGGGCTCCAGG - Intergenic
1155154059 18:23143780-23143802 GTGGTGGCCCGAGGGGCTCCTGG + Intronic
1156517909 18:37696718-37696740 GCCCTGCCCCGGGCAGCTTCAGG + Intergenic
1157593273 18:48848729-48848751 GCCCTTCCCCCAGGGACTCCAGG + Intronic
1157674876 18:49561607-49561629 GCTCTCCCCCGACGGACTCCCGG + Intronic
1157702069 18:49767757-49767779 ACCCTGGCTCCAGGGGCTCCAGG + Intergenic
1157736156 18:50051528-50051550 GGCCTGCACAGAGGTGCTCCAGG + Intronic
1158437943 18:57447216-57447238 GCTCTGCTACCAGGGGCTCCAGG - Intronic
1158566273 18:58556755-58556777 GCCCAGCCCTCAGGGGCTCTAGG - Intronic
1158566284 18:58556794-58556816 GCCCAGCCCTCAGGGACTCCAGG - Intronic
1159586596 18:70288833-70288855 GCCCCGCCCCGCGCGGCCCCCGG + Intergenic
1160377658 18:78426093-78426115 GGCCTGCCCCGAGTGGCTGCAGG - Intergenic
1160501374 18:79402509-79402531 GCCCAGCTCTGCGGGGCTCCCGG - Intronic
1160533869 18:79580930-79580952 GCCCTCACCCCAGGGCCTCCTGG + Intergenic
1160866892 19:1260164-1260186 CCCCTTCCCCTGGGGGCTCCCGG - Intronic
1160870197 19:1274477-1274499 GCCCTGTCCCGGGCGGCACCTGG + Intronic
1161015526 19:1980996-1981018 GCCCTGCCGCGTGGGGCGCGTGG + Exonic
1161059756 19:2209083-2209105 GCCGGGCCCCGAGGGGCGGCAGG - Intronic
1161126416 19:2560495-2560517 GCCCTGCTCCCAGGGGACCCTGG + Intronic
1161153489 19:2721170-2721192 GCCCTTCCCCGCGTGGCTCCGGG - Intronic
1161154830 19:2727201-2727223 TCACTGCCCCGAGGGGTTGCAGG + Intronic
1161401453 19:4067533-4067555 GCCCGGGTCCGCGGGGCTCCCGG + Intergenic
1161448306 19:4329928-4329950 CGCCTGTCCCGAGGGGCTGCAGG - Intronic
1161572817 19:5039784-5039806 GCCCTGCCCTGAGGGTCTGAGGG + Intronic
1161604396 19:5206678-5206700 GCCCTGCCCACTGGGGGTCCAGG + Exonic
1161610592 19:5240250-5240272 CTCCTGCCGCGGGGGGCTCCAGG + Exonic
1161626805 19:5331767-5331789 GCCCTGCCCCGCGGGACAGCCGG + Intronic
1161685460 19:5700613-5700635 GCCCTGCCCCCGAGGGCTCGAGG - Intronic
1161697270 19:5776351-5776373 GACCTGCCCCCAGGGGCACCAGG - Intronic
1162440394 19:10688684-10688706 GCTGTGCCACCAGGGGCTCCAGG - Intronic
1162534112 19:11253156-11253178 CCCCTCCCTCCAGGGGCTCCAGG + Intronic
1162729592 19:12710433-12710455 GCCTTGCACTGTGGGGCTCCAGG + Intronic
1163266940 19:16227342-16227364 GCCCTGCCCCTGGGGACCCCAGG + Intronic
1163316078 19:16541695-16541717 GCCCTGCACAGAGCGGCTGCTGG - Intronic
1163577259 19:18118075-18118097 GTCCGGCTCCGCGGGGCTCCTGG + Intronic
1163609097 19:18291990-18292012 GCCCTGCCCCGGAGGGGTCAGGG + Intergenic
1163754883 19:19100774-19100796 ACCCTGCACTGTGGGGCTCCAGG + Intronic
1163821490 19:19498916-19498938 GCCAGGCCCCGAGAGGCTCAGGG + Intronic
1164574331 19:29396905-29396927 GCCCTGCCCTGAGGGAAACCAGG + Intergenic
1166364849 19:42273109-42273131 GCCCTGCCAGGAGGGGAGCCAGG + Intronic
1166471605 19:43083509-43083531 GCCATGTCCCGCGGGGTTCCTGG - Intronic
1166482749 19:43187325-43187347 GCCATGTCCCGCGGGGTTCCTGG - Intronic
1166485223 19:43206459-43206481 GCCATGTCCCGCGGGGTTCCTGG - Intronic
1166492373 19:43270377-43270399 GCCATGTCCCGCGGGGTTCCTGG - Intergenic
1166596219 19:44052299-44052321 GCCCTGCTCTGAGGGTTTCCAGG + Intronic
1166887667 19:45971851-45971873 GCCCTGCCGTGGGGGGCTCAGGG - Intronic
1166891808 19:45998653-45998675 GCTCTGCCCTCACGGGCTCCTGG + Intronic
1166982320 19:46638755-46638777 ACCCTGCCCCGAGAGGCCGCAGG + Intergenic
1167040222 19:47019551-47019573 GTCTTGTCCCGAGGGGCTGCTGG + Intergenic
1167558010 19:50207511-50207533 GCCCTGCCTGGAGGAGCTCCTGG - Intronic
1168407877 19:56120429-56120451 GCCCTGCCCCGTGGGCCACGCGG + Intronic
925923395 2:8653229-8653251 GCCCTGAGCCCAGGGCCTCCTGG + Intergenic
926220916 2:10934932-10934954 GCCCTGCCCTCAGGGGCTCATGG - Intergenic
926765456 2:16319547-16319569 GCCCTGCCCTCAGGGATTCCAGG - Intergenic
926880373 2:17538897-17538919 GCACTGCGCTGCGGGGCTCCCGG - Intergenic
927209015 2:20627347-20627369 CCCCTGCCCCGAGGGGCCCGTGG - Intronic
927652208 2:24919788-24919810 GCCGGGCCCCGAGGCGCTGCCGG - Exonic
927713916 2:25341154-25341176 GCCCGCCCCCGGGGGCCTCCCGG + Intronic
929047271 2:37802237-37802259 GCCCTGCCCCAAGGGGCTTCAGG - Intergenic
929827845 2:45323507-45323529 GCCCTGCTCCAAGGGGCTTGAGG - Intergenic
930733342 2:54750094-54750116 GCCCTGCCACGGTGAGCTCCAGG + Intronic
932337035 2:70937466-70937488 GCCCTGCCCCATGGAGCTCGGGG + Intronic
932438962 2:71719747-71719769 GCCCTGCCTCCAGGGGCTCTGGG - Intergenic
932448434 2:71794747-71794769 GGCCTTCCCAGAGGGGCTCCTGG + Intergenic
932798097 2:74715391-74715413 GCCCTGAGCCGCGGGGCTCCAGG - Intergenic
933188296 2:79303429-79303451 GCCCTGCCCTAATGAGCTCCAGG + Intronic
933255811 2:80079482-80079504 GCCCTGCCTCTAGGAGCTCCAGG + Intronic
933769206 2:85732630-85732652 GGCCTGCCCTGAGGTCCTCCTGG + Intergenic
934188103 2:89763836-89763858 GCTGTGGCCTGAGGGGCTCCTGG + Intergenic
934308503 2:91844118-91844140 GCTGTGGCCTGAGGGGCTCCTGG - Intergenic
935418257 2:102841234-102841256 GCCCAACTCCGAGGGGCACCAGG + Intronic
937047826 2:118861459-118861481 TCCCTGCCCCCAGGGCTTCCAGG + Intergenic
938368814 2:130756206-130756228 GCCCGACCCCGCGGGGCCCCTGG + Intronic
940830880 2:158463927-158463949 CTCCTGCCCCGAGGGGCCCCAGG - Intronic
945996129 2:216437999-216438021 CCCCTGCCCTCAGGGGCTCAGGG - Intronic
946279434 2:218656161-218656183 ACCCTGACCCCAGGTGCTCCTGG - Exonic
946432393 2:219632591-219632613 GCCCTGCCCCTCGGGGCTCACGG - Intronic
947055105 2:226091557-226091579 TCCCTGCCCCAAATGGCTCCTGG + Intergenic
947670928 2:231934879-231934901 GCCCTGCCCTCAGGGACCCCGGG - Intergenic
948143420 2:235691173-235691195 CCCCAGCCCCGAGAGGCTCTGGG + Intronic
948605071 2:239129679-239129701 GCCCAGCCCCAAGTGCCTCCAGG - Intronic
948607064 2:239142609-239142631 GCCCTGCCACGCATGGCTCCTGG + Intronic
948607071 2:239142652-239142674 GCCCTGCCACGCATGGCTCCTGG + Intronic
948617613 2:239211357-239211379 GCCCTGCCCCGTGCTTCTCCTGG + Intronic
948830357 2:240595581-240595603 GCCTGGACCCGGGGGGCTCCTGG + Intronic
948901194 2:240957702-240957724 GGGCTGCCCAGAGGAGCTCCTGG + Intronic
948958607 2:241315149-241315171 GCCCTCCCCCGCGGGGCGGCGGG + Intronic
949027802 2:241774539-241774561 CCCCTGCCCCGAGGTGGCCCTGG + Intergenic
1168804719 20:665645-665667 GCCCAGCCCCCAGGGTCTCAGGG - Intronic
1169196083 20:3682504-3682526 GTCCTGCCCCGAGGGTGCCCTGG + Intergenic
1170573968 20:17648815-17648837 GCCTTGCCCAGAGGTCCTCCAGG - Intronic
1172128046 20:32636877-32636899 GCCCAGGCCTGAGGGGTTCCAGG - Intergenic
1174142334 20:48424628-48424650 GCAATGCACAGAGGGGCTCCAGG - Intergenic
1174573824 20:51523404-51523426 GGGCTGCGGCGAGGGGCTCCGGG + Exonic
1174672137 20:52318337-52318359 ACCCTGCCCCACGGGGCCCCAGG - Intergenic
1175140887 20:56859638-56859660 GCCCTGCCACTGGGGGCTGCTGG + Intergenic
1175736560 20:61391288-61391310 GCCCAGCCCCGACGGCTTCCAGG - Intronic
1175933793 20:62505911-62505933 GACCTGCCCAGTGGGGCCCCTGG + Intergenic
1175964577 20:62654134-62654156 TTCCTGCCCCCAGTGGCTCCCGG + Intronic
1175975475 20:62708563-62708585 GCCCTGCCCCGGGGAGCGCGAGG + Intergenic
1176028768 20:63000151-63000173 GTCCTGTCCCCAGGGGCCCCGGG + Intergenic
1176179075 20:63741175-63741197 GCCCTGCTCCTGGCGGCTCCGGG + Intronic
1176180607 20:63747719-63747741 GCCCTGTCCCAAGGGGATGCTGG + Intronic
1178702395 21:34844732-34844754 GCCCTGCCCCCTGGGCCTCGGGG + Intronic
1179178534 21:39026207-39026229 TCCCTGCCCTCATGGGCTCCTGG + Intergenic
1179504743 21:41832991-41833013 ACCCTGCGCCGAGGGGATCTAGG + Intronic
1179801012 21:43811476-43811498 GGTCTGCCCTGGGGGGCTCCAGG + Intergenic
1179830810 21:43994771-43994793 GCTCTGCCCTGGGGGTCTCCAGG + Intergenic
1180057964 21:45368749-45368771 GCCCTTCTCCCAGGGGCCCCGGG - Intergenic
1180067566 21:45420289-45420311 GCCCAGCCCCGAGGGTCTCGTGG + Intronic
1180105666 21:45616667-45616689 GCCCCTCCCCGCCGGGCTCCCGG + Intergenic
1180122861 21:45765542-45765564 GCCCCTCCCCGTGGGGCTCCTGG + Intronic
1180353809 22:11823445-11823467 GCGCAGGCCCGAGGCGCTCCCGG + Intergenic
1180384436 22:12168914-12168936 GCGCAGGCCCGAGGCGCTCCCGG - Intergenic
1180535590 22:16391197-16391219 GCTGTGGCCTGAGGGGCTCCTGG - Intergenic
1180614887 22:17120660-17120682 GCCCCCCGCCGAGCGGCTCCCGG + Exonic
1180732753 22:17994291-17994313 GCCATTCCCCTGGGGGCTCCAGG + Intronic
1181056102 22:20261210-20261232 GTCCTGCCCTGGGGGGATCCAGG - Intronic
1181182806 22:21079296-21079318 CCCCTGCCCTGAGAGGCCCCAGG - Intergenic
1181625450 22:24119539-24119561 GGCCTTCCCCCAGGGGCTGCCGG + Exonic
1181876020 22:25941446-25941468 GCCTTCCCCTGAGGAGCTCCAGG - Intronic
1182279396 22:29209188-29209210 CCCCTGCCACGAGGGGCCCAGGG - Intronic
1182296049 22:29311685-29311707 GGCCGGCCCCGGGGGGCCCCAGG + Intronic
1183190368 22:36318578-36318600 TCTCTGCCCCGTGGGGCTCAGGG - Intronic
1184089250 22:42283714-42283736 GCCCTGGCCCGAGGCTCCCCGGG - Intronic
1184234028 22:43173678-43173700 GCCCTGAGCCCTGGGGCTCCTGG + Intronic
1184245093 22:43231720-43231742 GCCATGCCCCGGGTGGCTCTCGG - Intronic
1184595106 22:45509193-45509215 ACCCTGCTCCAAGGGCCTCCTGG - Intronic
1184647992 22:45906529-45906551 GCTCTGCCCCCAGGGCCTCAGGG + Intergenic
1184693731 22:46128758-46128780 GCGCTGCCACATGGGGCTCCTGG - Intergenic
1184720844 22:46312256-46312278 GCCCTGGCCCAAGTGGCTTCCGG - Exonic
1184795806 22:46731724-46731746 GCCCTGCCCCCACCTGCTCCCGG - Intronic
1184827608 22:46963679-46963701 GTCCTGCCCGGAGTGGCACCTGG - Intronic
1184931149 22:47682252-47682274 CTCCTGCCCCGAGGGCCTCAGGG - Intergenic
950486021 3:13274378-13274400 GGCCTGCCCAGAGGGTGTCCTGG - Intergenic
950629690 3:14274261-14274283 GCCGTGCTCACAGGGGCTCCTGG - Intergenic
950995864 3:17495019-17495041 CCCTTGCCCCGTGCGGCTCCCGG + Intronic
954135298 3:48579586-48579608 ACCCTTTCCCCAGGGGCTCCAGG + Exonic
954194896 3:48990620-48990642 TCCCTGCCCCGCCGCGCTCCAGG + Intronic
954221671 3:49158657-49158679 GCCCTGCCCCGAGTGGGCACCGG - Intergenic
954614567 3:51963051-51963073 CTCCTGCTCCAAGGGGCTCCTGG - Intronic
955281153 3:57596566-57596588 TTCCTGCCCCGGGCGGCTCCAGG + Intronic
955406169 3:58627072-58627094 GCCAGGACCCAAGGGGCTCCCGG + Exonic
957097755 3:75792575-75792597 GCCCTGGCTCGGGGAGCTCCAGG + Intergenic
960761346 3:121076518-121076540 GACCTGCCCTGAGTGGCTGCAGG - Intronic
961780243 3:129316673-129316695 GTCCCGGCCCGGGGGGCTCCAGG + Intergenic
961812136 3:129528004-129528026 GCCCTGCCCAGAGGAGCTCAGGG - Intergenic
963733067 3:148991420-148991442 GCGGTGGCCCGCGGGGCTCCGGG - Exonic
964790471 3:160449812-160449834 CCTCTGCCCCGAAGGGCTTCAGG + Exonic
965561050 3:170062743-170062765 ACCCTGTCCCAAGGAGCTCCAGG + Intronic
966852091 3:184170639-184170661 TCGCGGCCCGGAGGGGCTCCTGG - Exonic
968514767 4:1011473-1011495 CCCCCGCCCCGCCGGGCTCCCGG - Intronic
968653711 4:1769883-1769905 GCCCTGCCTCGGGGGGCTGAAGG - Intergenic
968985326 4:3871717-3871739 GCCCAGCCCCGCGGAGCCCCGGG + Intergenic
969138768 4:5051556-5051578 GCCCCGGCGCGAGGAGCTCCCGG + Exonic
969537064 4:7762877-7762899 CCCCTGCCCCCAGAGGCTCCTGG + Exonic
969622766 4:8286989-8287011 GCCCTGCACCTAGCGGCTCAGGG - Intronic
969669100 4:8579996-8580018 GCCTCGCACCGCGGGGCTCCAGG + Intronic
970560468 4:17277040-17277062 GCTCTGCCCCGAGTTGCTCCGGG - Intergenic
972542989 4:40056105-40056127 GCCCTCCCGCGGGGGGCTTCCGG - Intergenic
977606909 4:98993621-98993643 GCCCTGCCCCGTGGGGAGGCAGG + Intergenic
979540047 4:121870501-121870523 ACGCTGCTGCGAGGGGCTCCTGG + Intergenic
981491601 4:145346249-145346271 CGCCTGCCCCCAGGGACTCCGGG - Intergenic
982275991 4:153637749-153637771 GCCCTGCACGGAGAGCCTCCAGG + Intergenic
984734965 4:183099717-183099739 GCGGTGCCCCGAGGGGTCCCGGG + Intronic
984795884 4:183659459-183659481 GCCTGGCCCCGCGGGTCTCCGGG - Intronic
985005911 4:185535387-185535409 GCCCTGCGCCCTGGGGCTTCAGG - Exonic
985069569 4:186154874-186154896 GCCCTGGTCCTGGGGGCTCCAGG + Intronic
985535034 5:459835-459857 GCCCTCCTCAGAAGGGCTCCAGG + Intronic
985551601 5:535952-535974 GCCCTGCCCAGGTGGGCTGCGGG - Intergenic
985692818 5:1323123-1323145 GCCCTGAGCTGAGGGGTTCCTGG - Intronic
985692855 5:1323238-1323260 GCCCTGAGCTGAGGGGTTCCTGG - Intronic
985894462 5:2740260-2740282 GCCCTGGGCCGAGGCGCACCTGG - Intergenic
989480558 5:41925559-41925581 CCCAGGCCCCGGGGGGCTCCAGG - Intronic
991952143 5:71956690-71956712 GCCCTGCCGGGAGGGGCACGCGG - Intergenic
999240923 5:150126956-150126978 ACCCAGCCCTCAGGGGCTCCAGG - Intronic
999325803 5:150642629-150642651 GCCCTGCTACGAGGGACTCTAGG + Intronic
999438167 5:151580554-151580576 ACCCTCCCACAAGGGGCTCCTGG - Intergenic
1000240714 5:159405731-159405753 GCTCTTCCCTGAGGGGCTGCAGG - Intergenic
1001527387 5:172438364-172438386 GCCCTGCCCCAAGGGCCCCCAGG - Intronic
1001570538 5:172727681-172727703 GCCCTGCCAGGAGGGTGTCCTGG - Intergenic
1001949746 5:175807983-175808005 GCCCTGCTCTCAGTGGCTCCAGG - Intronic
1002452390 5:179326302-179326324 GCCATGTCCTGAGGGGCTCTCGG + Intronic
1002563816 5:180099268-180099290 GCCCTGCCCTGTGGAGCCCCTGG + Intergenic
1002781433 6:369794-369816 GCCCTCCCCGGAGGGGCTGGTGG + Intergenic
1002862790 6:1095000-1095022 GTCCTGAGCCGAGGGTCTCCTGG + Intergenic
1003008395 6:2403472-2403494 GCCCTGCCCCTAGGAGGTCTTGG - Intergenic
1004178803 6:13363843-13363865 GCCCTGCCACGTGGCTCTCCAGG - Exonic
1004864486 6:19838686-19838708 GCCCGTCCCCGAGGGCTTCCGGG + Intronic
1007262750 6:40575289-40575311 GCCCAGCTCCGAGGTGCTCCTGG + Intronic
1013272867 6:108559624-108559646 GCCCGGCTCCGCGGGGCTGCGGG - Intergenic
1017206314 6:151807747-151807769 GCCCTGCCCCGGGAGCCTGCGGG - Intronic
1017805573 6:157942636-157942658 GCCCTGCCCCGCGTTGCTGCTGG - Intronic
1018364002 6:163099954-163099976 GCCCAGCGCGGACGGGCTCCGGG + Intronic
1018390909 6:163341416-163341438 GCCCTGCCCCCCTGTGCTCCAGG + Intergenic
1018625125 6:165770845-165770867 GGCCTGTCCCCAGGTGCTCCCGG + Intronic
1018857309 6:167683924-167683946 GACCTGCCCCTTGGAGCTCCAGG - Intergenic
1019140277 6:169938324-169938346 GCCCTGGACAGAGGGGCTGCCGG - Intergenic
1019258718 7:67902-67924 GCCCTTCCTCCAGGGGCTCTGGG + Intergenic
1019528761 7:1493385-1493407 GCTCTGCCCCGAGGGCTTGCGGG - Intronic
1019534964 7:1523993-1524015 GCCCTGCACCGCTGGGGTCCTGG + Intergenic
1019613656 7:1949095-1949117 GCCCTGCTCCTTGAGGCTCCAGG + Intronic
1019661031 7:2224145-2224167 GCCCTGCCCTCAGGGACTCTCGG + Intronic
1019733715 7:2640491-2640513 GTCCTGCCACCAGGTGCTCCGGG + Intronic
1019776641 7:2915478-2915500 GCTCTGCCCCTGGGGGTTCCTGG + Intronic
1019894516 7:3973151-3973173 GCTCTGCCCTGAGGAGCGCCAGG + Intronic
1019996752 7:4729535-4729557 GTCCTGCCGGGTGGGGCTCCCGG - Intronic
1020130489 7:5556304-5556326 GCGCTCCCCCGAGGGACCCCCGG - Intronic
1020706046 7:11545615-11545637 TCCTGGCCCTGAGGGGCTCCTGG + Intronic
1022497036 7:30859787-30859809 TCCCTGCCTCCAGGGCCTCCTGG - Intronic
1022518282 7:30989196-30989218 GCCCTCCCCCGAGGCCCTGCGGG + Intronic
1023177571 7:37448561-37448583 GTCCTGCTCCGGGGGACTCCGGG - Intronic
1024541939 7:50482048-50482070 GCGCTGCCACTAGGGGCTCCAGG - Intronic
1025813517 7:64889744-64889766 GCTCAGCCCCACGGGGCTCCAGG + Intronic
1026009798 7:66628244-66628266 GCCCTTCCCCAAGATGCTCCCGG - Intergenic
1026900399 7:74033799-74033821 CCCATGCCCCACGGGGCTCCCGG + Intronic
1027774226 7:82444110-82444132 GACCAGCCCCGCGGGGCTCCCGG + Intergenic
1028725726 7:94085500-94085522 GCCCTATCCCGTGGGGCTACTGG - Intergenic
1029978158 7:104853035-104853057 GCCCTGCCCCGAGATGCTTCAGG - Intronic
1032266459 7:130373537-130373559 GCCCAGCCCCCACGGCCTCCCGG - Intergenic
1033252041 7:139768779-139768801 GCACTGCCAGGTGGGGCTCCAGG - Intronic
1034219223 7:149431562-149431584 GCCCTCCCCCCTGGGGCCCCCGG + Exonic
1034439224 7:151078005-151078027 GCCCTGCCTTGAGAGGATCCTGG - Exonic
1034488440 7:151380659-151380681 GCCCTGTGCCCAGGGGCTCGAGG - Intronic
1035281690 7:157782450-157782472 GCCCTCCACAGAGGGGGTCCAGG + Intronic
1036638865 8:10569667-10569689 GCCCAGGCCCGAGGGGCATCTGG - Intergenic
1036910920 8:12755863-12755885 CCCCTGCCGCGCGGGACTCCGGG + Intronic
1037143033 8:15540420-15540442 GCCCTGCCGCGATGGGGGCCCGG + Exonic
1038060617 8:23908067-23908089 CCCTTTCCCCGAGGGGCTCTTGG + Intergenic
1038416040 8:27396868-27396890 GCCCTTCCCTGCGGGGCTGCTGG + Intronic
1040071854 8:43195166-43195188 CCCATGCCCCGAGGTGTTCCAGG - Intronic
1040296726 8:46152727-46152749 GCCCCCACCTGAGGGGCTCCCGG + Intergenic
1040543720 8:48380895-48380917 GCGCTGCCCTAGGGGGCTCCGGG - Intergenic
1040934328 8:52767043-52767065 GCCCTGCCCCGATGGGACCAGGG - Intergenic
1042837892 8:73093450-73093472 GGCCTCCCCCGCCGGGCTCCTGG - Intronic
1046841144 8:118858535-118858557 GCCCTGCACTATGGGGCTCCTGG + Intergenic
1047214426 8:122864941-122864963 GCCCTGCCCTCAGGGGCCCTTGG - Intronic
1049090722 8:140511690-140511712 GCCCCGCCCCGCCGGGCTCTGGG + Intronic
1049257399 8:141621234-141621256 GCCTTGGCCAGAGGGGCTCCGGG - Intergenic
1049315978 8:141967862-141967884 TCCCTGCCCCGAGAACCTCCAGG - Intergenic
1049426798 8:142541381-142541403 GCTCTGCCCTGAGGGCCGCCTGG - Intronic
1049471284 8:142776078-142776100 GCCCTGCCTCCCGGAGCTCCTGG + Exonic
1049482646 8:142834384-142834406 ACCCTGAGCGGAGGGGCTCCCGG + Intronic
1049544147 8:143221715-143221737 CCCCTGCCCCAGGTGGCTCCGGG - Intergenic
1049674730 8:143884375-143884397 ACACGGCTCCGAGGGGCTCCCGG + Intergenic
1050330178 9:4537756-4537778 TCCCTACCCCCAAGGGCTCCTGG - Intronic
1050813364 9:9778234-9778256 TCCCAGCCCCGAATGGCTCCTGG + Intronic
1053050452 9:34957727-34957749 GCCGTCCCCCGCAGGGCTCCGGG - Intronic
1053267390 9:36725089-36725111 GCCCTGGTCTGAGGGGTTCCTGG - Intergenic
1057314260 9:93958681-93958703 GCCGGGCGGCGAGGGGCTCCGGG + Intergenic
1057921897 9:99104873-99104895 GCCCCGGCCCGATCGGCTCCCGG - Intronic
1058824420 9:108762033-108762055 GCCCTGCCCCAAGGTTCACCGGG + Intergenic
1059395630 9:114032439-114032461 GCCCTGCCAGGAGGGTCTCTTGG + Intronic
1060375451 9:123112320-123112342 CGCCTGCCCCGCGGGGCTGCTGG + Intronic
1060396957 9:123322945-123322967 GCCAGGCTCCGAGGGGGTCCTGG + Intergenic
1060412132 9:123406818-123406840 CCCCTGCCCCGCGGGGCCCCGGG + Intronic
1060481226 9:124017839-124017861 GCCCGGGCCCGAGGGGCTGCGGG - Intronic
1060596705 9:124853052-124853074 GCCCTGCCCCACAGGACTCCAGG - Intergenic
1060945200 9:127566417-127566439 CACCAGCCCCGTGGGGCTCCTGG + Intronic
1061053145 9:128207755-128207777 GCCCTGCCCCGAGTGCTTCCTGG - Intronic
1061127946 9:128688886-128688908 TCCCTGCTCCGCGGGGCACCGGG - Intronic
1061180253 9:129021298-129021320 GCCCTGCCCACAGGTGCACCTGG + Intronic
1061208279 9:129176794-129176816 CCCCAGCCCCGCGGGGCCCCGGG + Exonic
1061502829 9:131013555-131013577 CCCCTGTCCTGAGGGGCTCAGGG + Intronic
1062236927 9:135514823-135514845 GCCCTCCCCTGCTGGGCTCCAGG - Intergenic
1062326700 9:136015838-136015860 GCCCGGCCCCCACGGGCTTCTGG + Intronic
1062354705 9:136156516-136156538 GCCCTGTGCTGTGGGGCTCCAGG + Intergenic
1062358232 9:136175184-136175206 GCCCAGCCCACGGGGGCTCCAGG - Intergenic
1062395870 9:136352577-136352599 GCCCTGGCTCAAGGGCCTCCCGG - Intronic
1062430709 9:136525748-136525770 GCCTTACCCCGAGGGGCTTGTGG + Intronic
1062525925 9:136978132-136978154 GCGCTTCCCCGAGCAGCTCCCGG - Intronic
1185865401 X:3619626-3619648 TCCCAGCCCCTGGGGGCTCCGGG - Intronic
1186247578 X:7631268-7631290 TCCCAGCCCTGAAGGGCTCCTGG + Intergenic
1186496622 X:10016105-10016127 ACCCAGCCCCGAGGGCCTCCTGG - Intronic
1187228422 X:17397198-17397220 GCCATGCCGGGAGGGGCTCCTGG - Intronic
1187473434 X:19589233-19589255 GCCCTGCCCTCAGGGGCTGTCGG - Intronic
1187526244 X:20057711-20057733 ACCCAACCCCGAGGTGCTCCAGG + Intronic
1190160123 X:48026183-48026205 TCCCTGCCTAGTGGGGCTCCAGG - Intronic
1192510751 X:71719226-71719248 CCCTGGCCCCGTGGGGCTCCGGG - Intergenic
1192515946 X:71762327-71762349 CCCTGGCCCCGTGGGGCTCCGGG + Intergenic
1194330767 X:92580871-92580893 CCCTTGCCCCGTGTGGCTCCTGG + Intronic
1198095356 X:133374713-133374735 GCCCTGCTATGAGGAGCTCCTGG - Intronic
1198267366 X:135022094-135022116 CCCCAGGCCCGAGGGTCTCCCGG + Exonic
1198268521 X:135032727-135032749 CCCCAGGCCCGAGGGTCTCCCGG - Exonic
1199976521 X:152897874-152897896 GCCCCGCCCCGCGGGGCTGCTGG - Intergenic
1200143961 X:153916383-153916405 GCCCTGCTCCGTGGGGAGCCTGG - Intronic
1200639471 Y:5699941-5699963 CCCTTGCCCCGTGTGGCTCCTGG + Intronic