ID: 1076526584

View in Genome Browser
Species Human (GRCh38)
Location 10:131116077-131116099
Sequence TTGGATTTCCTTACAAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076526584_1076526590 28 Left 1076526584 10:131116077-131116099 CCTTATTTTGTAAGGAAATCCAA 0: 1
1: 0
2: 2
3: 21
4: 290
Right 1076526590 10:131116128-131116150 TTTATACCCAAAGCCAAAGCAGG No data
1076526584_1076526588 0 Left 1076526584 10:131116077-131116099 CCTTATTTTGTAAGGAAATCCAA 0: 1
1: 0
2: 2
3: 21
4: 290
Right 1076526588 10:131116100-131116122 CTGGGCTGAAATACTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076526584 Original CRISPR TTGGATTTCCTTACAAAATA AGG (reversed) Intronic
901552336 1:10004717-10004739 TTTGATTTGCTTACATAATAGGG + Intronic
902558717 1:17262394-17262416 TTCAATTTGCTTACAAAAGAGGG - Intronic
908338523 1:63152066-63152088 CTCTATTTCCTTCCAAAATAGGG + Intergenic
909115440 1:71528614-71528636 TGGAATTTCTTTACATAATATGG + Intronic
909907041 1:81209636-81209658 TTGGATTCCCCTTCAAAATTTGG - Intergenic
910463249 1:87470142-87470164 TTTGCTTTCCTTCCTAAATATGG - Intergenic
911324780 1:96457663-96457685 TTTGATTTCCTTAATAGATATGG + Intergenic
912173231 1:107126238-107126260 TTGGATTGTGTAACAAAATATGG - Intergenic
913576560 1:120181047-120181069 TAGGCTTTCCTGACAAAGTAGGG - Intergenic
914558466 1:148792482-148792504 TAGGCTTTCCTGACAAAGTAGGG - Intergenic
914614369 1:149337748-149337770 TAGGCTTTCCTGACAAAGTAGGG + Intergenic
916140339 1:161691936-161691958 TTGGCTTTCCTTAGAAACTGGGG + Intergenic
917324535 1:173818503-173818525 TTTGATCTCCTTTCAAACTAGGG + Intronic
918536032 1:185575460-185575482 TTGAAATTCATTAAAAAATAAGG - Intergenic
918544443 1:185666311-185666333 TTGGATTTCCTTACAAGAAGAGG - Intergenic
918600412 1:186352234-186352256 TTGTATTTCCTTATACAATGAGG - Intronic
922976819 1:229791859-229791881 CTGGCTTTCCTTAAAAAAAATGG - Intergenic
923258027 1:232238710-232238732 TTGGTTTTCATTATAAAATGGGG - Intergenic
924353529 1:243144801-243144823 TTCCATTTTATTACAAAATATGG + Intronic
1063756118 10:9010696-9010718 TTGTATTTACTTTCAACATATGG + Intergenic
1064487869 10:15815047-15815069 TTAGTTTTCCTTAAAGAATAAGG + Intronic
1067811189 10:49428647-49428669 ATGGATTTCCTTATGAAAGATGG - Intergenic
1067965128 10:50903670-50903692 TTTGAGTTCCTTACAAATTCTGG - Intergenic
1068193515 10:53685429-53685451 TTGTATTTCCTTACATATTTGGG - Intergenic
1068204143 10:53826934-53826956 TTGGTTTTGATTACCAAATAGGG + Intronic
1068494253 10:57765517-57765539 TGGGATTTTCTAACAAAATGTGG - Intergenic
1069747007 10:70721895-70721917 TTGGATTTTCATACAAGCTACGG + Intronic
1071773015 10:88751239-88751261 TTGGATTTCCTCACATACTTGGG - Intronic
1072338003 10:94417468-94417490 ATTAAATTCCTTACAAAATATGG - Intronic
1073856882 10:107686405-107686427 TTGAATTACCTTTCTAAATAGGG + Intergenic
1074177075 10:111018499-111018521 TTGTATTTCCTTAAAGAATTGGG + Intergenic
1074788739 10:116865152-116865174 TAGGAATTCTTTACATAATAAGG + Intronic
1076435673 10:130439692-130439714 TGTTATTTCCTTCCAAAATAGGG + Intergenic
1076526584 10:131116077-131116099 TTGGATTTCCTTACAAAATAAGG - Intronic
1076551992 10:131286429-131286451 GTGCATTACCTTACACAATACGG - Intronic
1078881256 11:15451027-15451049 TTGCATTTCCTTATAAACTCGGG - Intergenic
1082672057 11:56046191-56046213 TTGGATTTCCTTTGAATACAGGG - Intergenic
1087577456 11:100007367-100007389 TTGCATCTTCTTTCAAAATAAGG + Intronic
1087842482 11:102934781-102934803 TTCTATTTCCTTTCAAAATGAGG - Intergenic
1089625794 11:119750057-119750079 TGGGATTTCCTGGCAAAATTTGG - Intergenic
1089794018 11:120966060-120966082 TTAGATTTCATTACAAAAACAGG - Intronic
1090034875 11:123240351-123240373 TTAGTTTTGCTTTCAAAATAAGG + Intergenic
1090155209 11:124430233-124430255 TTGGAATTCCTTCCAAATTGAGG + Intergenic
1090978656 11:131697131-131697153 TCAGATTTCCTTTCAAGATAAGG + Intronic
1092295488 12:7194589-7194611 GGGGATTCCATTACAAAATAAGG - Intronic
1092503576 12:9072068-9072090 TAGGATTTCATTACATAACAAGG + Intronic
1093603606 12:21062457-21062479 TTGAGTCTTCTTACAAAATAAGG - Intronic
1094248775 12:28334704-28334726 TTGGATTTCCTTACTTTATTAGG - Intronic
1094748204 12:33371562-33371584 TTGGATTCACCTGCAAAATATGG - Intergenic
1095302009 12:40595951-40595973 TTTGATTTCCTTATATAATCTGG - Intergenic
1095328526 12:40928111-40928133 TTGTATTTCCTTACAGAGAAAGG - Intronic
1095549569 12:43417831-43417853 TTAGATTTCCTGACAGAAGAAGG + Intronic
1096936577 12:55286513-55286535 CTGGAATTTCTTACAAAAGAGGG + Intergenic
1097849086 12:64393917-64393939 TTGGATGAACTTACAAGATAAGG - Intergenic
1100085921 12:90910563-90910585 GTAGATTTCCTTATAAATTATGG - Intronic
1102843866 12:116156647-116156669 TTAAATATTCTTACAAAATAAGG - Intronic
1103658367 12:122493361-122493383 GCCGATTTCCTTACAAATTAGGG + Intronic
1103770748 12:123321894-123321916 TTGGACTCCCATAAAAAATAAGG + Intronic
1104521234 12:129477254-129477276 TTTGATTTCTTTTGAAAATAAGG + Intronic
1104630335 12:130395432-130395454 TTGTACTTACTTATAAAATAGGG + Intergenic
1104671667 12:130685065-130685087 TTGGATTCTCTTGAAAAATAAGG + Intronic
1105591474 13:21796663-21796685 TTGGATTTCCACACAAAAAAGGG - Intergenic
1107757194 13:43637196-43637218 TTGGAATTCCATAAAAAGTAGGG - Intronic
1109341083 13:61059890-61059912 TTGGATTTCATTCCAAAGTCAGG - Intergenic
1109569976 13:64175242-64175264 TTAGATTTTATTAGAAAATATGG - Intergenic
1109817389 13:67603325-67603347 TTGGAATACTTTACAAAGTATGG + Intergenic
1110043775 13:70801186-70801208 TTGTATTTTCATATAAAATAGGG + Intergenic
1110126597 13:71950998-71951020 TTGTTTTTCCTTTGAAAATAAGG + Intergenic
1110917494 13:81040959-81040981 TTACATTTCCATACAAAATTTGG - Intergenic
1111108086 13:83672234-83672256 ATGGACTTCCTTAGAAAACATGG - Intergenic
1111399813 13:87719976-87719998 TTGGATTATATTAGAAAATAGGG - Intergenic
1112660591 13:101503204-101503226 CTGGATCTCCTGAAAAAATATGG + Intronic
1113234002 13:108248967-108248989 TTGGATTTTTTAACAATATATGG - Intergenic
1113700564 13:112383377-112383399 TTGTTTTTCTTTAAAAAATAGGG - Intronic
1115666140 14:35550436-35550458 TTGCATTTTTTTAAAAAATAAGG - Intronic
1117139199 14:52769313-52769335 TTGGATTAACTTTGAAAATAAGG - Intronic
1117345827 14:54831374-54831396 TTGAAGTTCCTTATAAAATCTGG + Intergenic
1118233019 14:63971605-63971627 TTTAATTTCCTTAAAATATATGG - Intronic
1118588005 14:67374743-67374765 TTGGAATGCCTCATAAAATACGG + Intronic
1122434299 14:101683223-101683245 CTGGATTTCCTTAAAGAAAATGG - Intergenic
1122682305 14:103474905-103474927 TTAGATCATCTTACAAAATATGG + Intronic
1123858109 15:24434955-24434977 TTGCTTTTCCTTGCAAAACATGG - Intergenic
1123862736 15:24485413-24485435 TTGCTTTTCCTTGCAAAACATGG - Intergenic
1124331126 15:28816705-28816727 TTACATTTACTTATAAAATATGG - Intergenic
1125154881 15:36574555-36574577 TTGGATCTCCTAACAAACTGGGG + Intergenic
1127380274 15:58424959-58424981 TTTGATTTTCTTAACAAATAAGG - Intronic
1127542621 15:59956579-59956601 TTGGACTTCATTAGAAATTAAGG - Intergenic
1128540582 15:68526970-68526992 ATTGATTTCCTTACAAAAAGAGG + Intergenic
1130879282 15:88041298-88041320 TTGTACTTCCTTCCAAAGTAGGG + Intronic
1135874240 16:26182864-26182886 TTTGCTTTGCTTGCAAAATAAGG + Intergenic
1137294877 16:47082265-47082287 TTGGTTTTGCTTACAGCATATGG - Exonic
1137595891 16:49723460-49723482 TAGGAGTTCCTTACACATTAAGG + Intronic
1137967018 16:52945335-52945357 TTCAATTTCCTTACTAATTATGG - Intergenic
1138761817 16:59553322-59553344 TTGTATTTCTTTTTAAAATATGG + Intergenic
1140825880 16:78706170-78706192 TTTGATATCCTTATTAAATAGGG - Intronic
1141079754 16:81039549-81039571 CTGGATTTCCTTACAGGATATGG - Intronic
1143875241 17:9986282-9986304 TGGGACTTCCTTTTAAAATAAGG - Intronic
1143914891 17:10283356-10283378 TTACATTTCCTTATAAAATCTGG + Intergenic
1146961088 17:36980104-36980126 TTGCTTGTCCTTACAAAATAAGG - Intronic
1149157747 17:53653291-53653313 TTGGTTTTCATTATAAAATAAGG - Intergenic
1149666587 17:58369175-58369197 TTCTCTTTCCTTACAAAATATGG - Intronic
1151052750 17:70996947-70996969 TTGGGTTTCCTTACAGGATTGGG - Intergenic
1153288799 18:3480555-3480577 TTGGTTTTGCTTTCAAAGTAGGG + Intergenic
1153456500 18:5288243-5288265 TTTTTTTTCCTAACAAAATAGGG + Intergenic
1155635730 18:27952958-27952980 TTTGATGTCCTTCCAAAATGAGG - Intronic
1155764429 18:29609811-29609833 TTTGATTGCCTTAAAAACTATGG + Intergenic
1157089622 18:44622113-44622135 TTGGATTGCTTTGCCAAATATGG - Intergenic
1159298843 18:66534928-66534950 TTGTAATTATTTACAAAATATGG + Intronic
1159669852 18:71209989-71210011 GTGGATTTCCATAATAAATAAGG - Intergenic
1162061651 19:8099587-8099609 TTTGATTTTTTTAAAAAATAAGG + Intronic
1162660084 19:12162137-12162159 TTTGATTTCTTTACAGATTACGG + Intergenic
1164387599 19:27788839-27788861 TTTGATTTCCTTATAAGTTATGG - Intergenic
1167319084 19:48784611-48784633 TTGAATTTACATGCAAAATATGG + Intergenic
925029684 2:640028-640050 TTGGATCTGCTCACAAAATATGG + Intergenic
926078799 2:9966474-9966496 TTAGTTTTCCTTACAATATTAGG + Intronic
927010194 2:18896127-18896149 ATATATTTCCCTACAAAATAAGG - Intergenic
927411754 2:22833888-22833910 TTGAATTTCCTCTCAAAACAGGG + Intergenic
928534023 2:32221942-32221964 ATGGAGTTCCATACATAATATGG + Intronic
929198401 2:39209801-39209823 TGGGAGTTCCTTTAAAAATAAGG + Intronic
929839217 2:45439577-45439599 TTTGATTTTCTGCCAAAATAAGG + Intronic
930639300 2:53839015-53839037 TTTGATATACATACAAAATATGG + Intergenic
931763129 2:65433534-65433556 TTGCATTTCCGTAGAAATTATGG + Intergenic
932200117 2:69819015-69819037 TGGTATTTCATTTCAAAATAAGG - Intronic
933044553 2:77519094-77519116 TTGGAGTTCCTTACACAACTTGG - Exonic
933078479 2:77958508-77958530 TAGTATTTCATAACAAAATAGGG + Intergenic
933082669 2:78012601-78012623 TTTGTTTTTCTTACTAAATATGG + Intergenic
933985365 2:87586660-87586682 CTTGCTTTCCTTACAGAATATGG - Intergenic
935139834 2:100343373-100343395 TTGAATTTCATTTCAAAAAATGG - Intergenic
936308476 2:111364149-111364171 CTTGCTTTCCTTACAGAATATGG + Intergenic
936407218 2:112216152-112216174 TTGGATTTCCTTAATAAAATCGG - Exonic
939111280 2:138010784-138010806 TTGGATTTCTTTAAAAAATGTGG + Intronic
939131296 2:138238500-138238522 TGTGATTACCCTACAAAATATGG + Intergenic
939277813 2:140023434-140023456 ATGGATTTCAGCACAAAATAAGG - Intergenic
940921936 2:159317241-159317263 TTGAATTTCCTTAAAGAATATGG + Intergenic
940928044 2:159390253-159390275 TTTGATTTTCTATCAAAATAAGG + Intronic
941336516 2:164251210-164251232 TAAGATTTCCTGAGAAAATAAGG - Intergenic
942683501 2:178506404-178506426 TTGAATTTTCTTACATCATATGG + Exonic
943122629 2:183756006-183756028 TTGGATTGCTTTTCATAATATGG - Intergenic
943416250 2:187609572-187609594 TTGGATTTCCTAATAAATTCTGG + Intergenic
943542556 2:189235648-189235670 ATGGATTACTTTACAAAAAATGG - Intergenic
944327051 2:198418342-198418364 TTGGATTTTCATGCAAAAGATGG + Intronic
945204013 2:207312425-207312447 TTGGACTTCATTACACAACATGG + Intergenic
945806440 2:214495729-214495751 TTGGATTTCTTTAGAAAAAATGG - Intronic
1169961562 20:11165913-11165935 ATGGACTTTCTTAGAAAATAAGG + Intergenic
1170211761 20:13852477-13852499 TTAGATTTTTTTACTAAATAGGG - Intronic
1171079035 20:22159074-22159096 GTAGATTTCCTTTCAAAATTTGG + Intergenic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1173306358 20:41854231-41854253 TAGGATTTCCTTTCAGAAAATGG + Intergenic
1173733798 20:45345877-45345899 CTGGGTTCCCTTCCAAAATATGG + Intronic
1176929700 21:14794129-14794151 TTGGAAGTCCTTTTAAAATAGGG - Intergenic
1177326118 21:19591081-19591103 CTTTATTTCCTTACAAGATATGG - Intergenic
1177404790 21:20651321-20651343 TTGGTTTTATTTACAAAATTTGG + Intergenic
1177481331 21:21693571-21693593 TTGGATTAGGTTACAAAAGATGG + Intergenic
1177834342 21:26172108-26172130 TTGGATGTCCTCAACAAATAAGG + Intergenic
1179817157 21:43913973-43913995 TGGGTTTTCCTTACAAAAGCTGG - Intronic
1180245931 21:46547244-46547266 TTGGATTCCTTAAGAAAATAAGG + Intronic
949465224 3:4336947-4336969 TTGGCTGCCCTTACAAATTAGGG - Intronic
951134890 3:19093765-19093787 TAGGATTTACTTACATAATCTGG - Intergenic
954854523 3:53632119-53632141 TGGGATCTCCTTACAATAGAAGG + Intronic
955319208 3:57962123-57962145 TTGGATTTCTGTATAAAATGGGG + Intergenic
956084978 3:65598496-65598518 TTGGAATTCCTTCCAAAGTTGGG - Intronic
956868256 3:73390433-73390455 TTTTATTTCCTGACAAAATTGGG + Intronic
957112218 3:75977571-75977593 TTGGGTTTTCTTAAAATATAAGG + Intronic
957217513 3:77340512-77340534 TTGAATTTTCTGGCAAAATAGGG + Intronic
957443176 3:80279687-80279709 TTGATTTTACTTACAGAATATGG - Intergenic
957837286 3:85612376-85612398 TTCCATTTTCTTGCAAAATAAGG + Intronic
958188593 3:90155344-90155366 TTTAATTGCCCTACAAAATATGG + Intergenic
958450328 3:94265246-94265268 CTTGATGTCCTGACAAAATAAGG + Intergenic
960628211 3:119702320-119702342 TAGGATTTCTTTAAAAAAGAGGG + Intergenic
960868680 3:122227926-122227948 TTAGATGTCCTTAGAAAATAGGG - Intronic
962506962 3:136056846-136056868 TTTGAGTTCCTTACAAATTTTGG - Intronic
963591621 3:147268061-147268083 TTGGATTTTATTATAAAATCAGG - Intergenic
963624777 3:147657817-147657839 TTGGATTTCCTTTTAAAAATTGG + Intergenic
963737188 3:149032520-149032542 TTTGCTTTCCTTACCCAATATGG + Intronic
964055277 3:152447926-152447948 GTGGTTTTCCTTAAAAACTAAGG + Intronic
965005436 3:163016948-163016970 TGGGATTTTCTTACAATATGAGG - Intergenic
965386832 3:168055921-168055943 TTGGATTTCTTTTCAGAAAATGG - Intronic
965432605 3:168607869-168607891 TTAGAGTTCGTTACAAAACAAGG + Intergenic
965446171 3:168777162-168777184 TTGGATTTCTTTTCAGAAAATGG - Intergenic
966589895 3:181670730-181670752 TTGGAATTCTTTACATATTAAGG + Intergenic
966716390 3:183017177-183017199 TGGTATTAACTTACAAAATAAGG + Intronic
970517122 4:16843921-16843943 TTGTATTTCTTTAAAAACTAAGG + Intronic
972131474 4:35840221-35840243 TTTGATTAACTTACAAAAGAAGG - Intergenic
972824886 4:42746393-42746415 TTGGAGGGCCTTAAAAAATAGGG + Intergenic
973564903 4:52175008-52175030 TTGGATTTGATAATAAAATAAGG + Intergenic
975179281 4:71325232-71325254 TTGGATTCCATTAAAAAAAAAGG + Intronic
975284520 4:72601701-72601723 TAGGATTGCCAGACAAAATAAGG - Intergenic
976059529 4:81110582-81110604 TTGGATTTGCGAAGAAAATAGGG - Exonic
977423640 4:96837275-96837297 TTGCATTTTCTTACACAGTAAGG + Intergenic
977761479 4:100742682-100742704 TTAGAGTTGTTTACAAAATAAGG + Intronic
978348546 4:107797490-107797512 ATGGGTTTCCTTATAAAATGAGG + Intergenic
978817343 4:112923389-112923411 GTGGAATTCCTTTCAAAATGAGG + Intronic
978865957 4:113511870-113511892 TTGCATTTCATTACAAATAATGG - Intronic
979248269 4:118534795-118534817 TTCCATTTTATTACAAAATATGG - Intergenic
979543187 4:121910081-121910103 TGGCATTTCCTTCCAAAATGTGG + Intronic
979594315 4:122516955-122516977 TTGAATTTCTTTACTAGATATGG + Intergenic
980337771 4:131498892-131498914 ATGTATTTGTTTACAAAATAGGG + Intergenic
980715940 4:136630085-136630107 TGGAATTTCCTAAAAAAATATGG + Intergenic
980812223 4:137896896-137896918 TTGCATTTGCTTCCAAAAGATGG + Intergenic
980854324 4:138421301-138421323 TTTATTTACCTTACAAAATAAGG + Intergenic
982750404 4:159154061-159154083 TTTGGTTTCCTTATAAAATTAGG + Intronic
983223973 4:165069110-165069132 TTGCATTTTCTTATCAAATAAGG - Intergenic
983434657 4:167697570-167697592 TAGGATTTCCTTATAGAAGAGGG - Intergenic
984307342 4:178010803-178010825 TTGCATTTCTTTAAAAAATCAGG + Intergenic
984381948 4:179005626-179005648 ATGGATTTCCTTCAGAAATATGG - Intergenic
984637564 4:182128181-182128203 ATGGATTACCATATAAAATAGGG - Intergenic
985974301 5:3403508-3403530 TTGTATTACCTTATAAAATGGGG + Intergenic
986455995 5:7919309-7919331 TTGCATTTCCATACAAATTTTGG + Intergenic
986852388 5:11829223-11829245 TTGGATTTCTTTTCAGAAAATGG - Intronic
987890526 5:23870436-23870458 TTGGAATTCTTTTCAAAATATGG + Intergenic
988669345 5:33364195-33364217 TTGAACTTCCTTAAAAAATGTGG - Intergenic
990832892 5:59980394-59980416 TGGGTTTGCCTTAAAAAATATGG + Intronic
991010754 5:61880777-61880799 TTGGATTTCCTTACCCAAAAAGG - Intergenic
993216447 5:85029072-85029094 TTAGATTCCCTTAAAACATAAGG - Intergenic
994826973 5:104725404-104725426 TTGTATTTCCTTAAAGAATCTGG + Intergenic
994832802 5:104808156-104808178 TTGCATTTCCTTAGTAACTAAGG + Intergenic
994995724 5:107060131-107060153 ATGGAATTCCTTTAAAAATAGGG - Intergenic
995440306 5:112184129-112184151 ATGGCTTTCCTTTCAGAATACGG - Exonic
996042822 5:118834948-118834970 TTGGATTTCCATAAAATATCAGG - Intergenic
996460116 5:123732303-123732325 TTGAATTTCTTTTCAAAAAATGG - Intergenic
996815796 5:127571217-127571239 TAGGATTTCCATAATAAATAAGG + Intergenic
997408495 5:133671414-133671436 TTAGTTTTACCTACAAAATAAGG - Intergenic
998010504 5:138691606-138691628 TTTGAGTTCCTTACATATTATGG + Intronic
998318623 5:141208265-141208287 TTGGCTTTCCTTACGTGATAAGG - Intergenic
998883136 5:146665219-146665241 TTGGATCTTCTTCCAACATAAGG + Intronic
999037734 5:148372231-148372253 TTGCTTTTCTTTAAAAAATAAGG - Intergenic
999541027 5:152572816-152572838 TTGAATTTCTCTTCAAAATATGG - Intergenic
999804958 5:155072483-155072505 TTGAATTTCTTCACAAAAAACGG + Intergenic
1004571221 6:16847506-16847528 CAGGATTGCCTTGCAAAATATGG + Intergenic
1004834837 6:19518796-19518818 ATGTATTTTCTTAGAAAATAGGG - Intergenic
1007982840 6:46176698-46176720 ATGGATTTTCCTACAAAATAGGG - Intergenic
1009170066 6:60387516-60387538 TTTATTTTCCTTACAAAATTAGG - Intergenic
1009219188 6:60963104-60963126 ATTGATTTCCTTTCAAAATTTGG + Intergenic
1009535920 6:64885305-64885327 TTTAATTTCATTTCAAAATATGG - Intronic
1009725402 6:67531108-67531130 CTGGATTGCCTTACAAGGTATGG + Intergenic
1009864986 6:69386363-69386385 TTGGACTTTCTTTCAAACTAAGG + Intronic
1010519923 6:76819732-76819754 TTGTACTTCTTTACAAAATCTGG + Intergenic
1010637337 6:78277098-78277120 TTGGATTTCCTTATCGATTATGG + Intergenic
1010733580 6:79416435-79416457 TTGACTTTCCTTGAAAAATATGG - Intergenic
1010922918 6:81706364-81706386 CTGCTTTTCCTTGCAAAATATGG + Intronic
1012507624 6:99966877-99966899 TTGGCTTTCATTATAAAATTAGG - Intronic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1013958003 6:115862727-115862749 TTGGATTTCATTGATAAATATGG - Intergenic
1014452982 6:121603466-121603488 TTGGATTTCCTTACACAAAATGG - Intergenic
1014698320 6:124651907-124651929 TTGGATTTCTTTCCTAAAAAAGG + Intronic
1015102728 6:129500343-129500365 TTGGATGTCCTTAAAAACAAAGG + Intronic
1015281445 6:131439086-131439108 TTTAAGTTCCTTACAAATTATGG - Intergenic
1015346823 6:132170249-132170271 TTGTAGTTCCATACAAACTATGG - Intergenic
1015718883 6:136219977-136219999 TTTGTTTACTTTACAAAATAAGG + Intergenic
1016525563 6:144998220-144998242 TTGGAGTTCCTTCCAAACTCCGG + Intergenic
1016689238 6:146916765-146916787 TTGGTTTTCCTTTTAAAATCTGG - Intergenic
1017364941 6:153624877-153624899 CTGGATTTCAATAAAAAATAAGG - Intergenic
1018333914 6:162763964-162763986 TTGGATTTTCTTTTAAAATGGGG + Intronic
1021128502 7:16882183-16882205 TTGAATGTCCTCATAAAATAAGG + Intergenic
1023901434 7:44483706-44483728 TTGGAATGGCTTATAAAATATGG - Intronic
1024450652 7:49538811-49538833 TAGGAGTTCCTTATAAATTATGG - Intergenic
1024546879 7:50529746-50529768 TTGCATTTGTTTATAAAATAGGG + Intronic
1024669720 7:51583471-51583493 TTGGCTTTCCCTACAAGATATGG - Intergenic
1026338589 7:69416100-69416122 TTGCATTTCCTTATATAATGAGG - Intergenic
1027810056 7:82884990-82885012 TTGGATTTCTTGACTTAATATGG + Intronic
1028437865 7:90825625-90825647 TTGTATAACCTTAAAAAATATGG + Intronic
1030252744 7:107465324-107465346 TTGGATTTTTTTAAAAAATTAGG + Intronic
1030738720 7:113083519-113083541 TTGAATTTCTTCTCAAAATATGG + Exonic
1030932813 7:115546082-115546104 ATGTATTCCCTTGCAAAATATGG - Intergenic
1031377518 7:121045753-121045775 TTGGATTTTCATCCAAAATGAGG + Intronic
1035076911 7:156185617-156185639 TTGGATCTCCTTTCAAAAGAAGG + Intergenic
1036512565 8:9414124-9414146 TTCGATGTCCTTAGAGAATATGG - Intergenic
1039634900 8:39153794-39153816 TTGGGTTTCCTTTGAAAATCAGG + Intronic
1042302594 8:67301502-67301524 TTGGGTTTCCTCTCGAAATATGG - Intronic
1042770787 8:72379669-72379691 TTTGATTTCCTTAGAAAGTCTGG - Intergenic
1043114504 8:76233436-76233458 TTGGGTTTCCTCACAACATTAGG - Intergenic
1044022903 8:87128757-87128779 TTGGATTTGCTTTCCTAATATGG + Intronic
1044097995 8:88093002-88093024 CTGGATTTCCTTAGAATATTTGG - Intronic
1044213520 8:89580135-89580157 TTAGATTTCCTTACAAGGTAAGG - Intergenic
1044790467 8:95841663-95841685 ATGGATCACCTTACAAAAAATGG + Intergenic
1045514566 8:102846642-102846664 TTGGATTTCCCAAAAAAAAAAGG - Intronic
1045707004 8:104935834-104935856 TTGGTTTTTCTTAGAAAACAGGG + Intronic
1046215720 8:111143315-111143337 TAGGATGTACCTACAAAATATGG - Intergenic
1048208956 8:132439011-132439033 TAGGATTTCTTCAGAAAATAAGG - Intronic
1048418492 8:134252938-134252960 GTGGATTTCCCTACTCAATATGG - Intergenic
1048523336 8:135177856-135177878 TTAGATTTACTTAGAAAATTTGG - Intergenic
1053148991 9:35731171-35731193 AAGGATTTCCCTACAAAAGAAGG + Intronic
1053402112 9:37834490-37834512 TTGGACTTTCATAAAAAATAGGG - Intronic
1054789921 9:69247191-69247213 TTAGAATTACTTAGAAAATAAGG + Intronic
1055163469 9:73160923-73160945 TTAGATTTCCTTTTCAAATAAGG - Intronic
1055226404 9:74002829-74002851 TTGTATATCCTTACAACATAAGG - Intergenic
1055591239 9:77816720-77816742 TTGTATTTCTATACAAAATCAGG - Intronic
1056753450 9:89367955-89367977 GTGGATGTGATTACAAAATATGG + Intronic
1059305874 9:113352728-113352750 TCTGATTTCCTTACAAAAGGTGG + Intronic
1060086453 9:120707602-120707624 TTGTATTTCCTTAAAATAAATGG + Intronic
1062677324 9:137754375-137754397 TAGGATTTCATTAGAAAAGAGGG + Intronic
1186309336 X:8300981-8301003 ATGGTTTTCCATACTAAATATGG - Intergenic
1186562540 X:10628303-10628325 TTAGATTTCTTTAATAAATATGG - Intronic
1187090553 X:16091658-16091680 TTGTATCTCATTAGAAAATAAGG - Intergenic
1187577028 X:20567985-20568007 TTGGATTTGTTTAAAAAAAAGGG + Intergenic
1188434064 X:30140134-30140156 TTGGATTTACTTAGGAAAAAAGG - Intergenic
1189069912 X:37852391-37852413 TTGGATTTTTTAACAAGATAGGG + Intronic
1189221402 X:39375345-39375367 TTGGTTTTCCTTGCACAATGTGG - Intergenic
1190514576 X:51209473-51209495 TTGCGCATCCTTACAAAATATGG - Intergenic
1190796779 X:53752903-53752925 TAGGAGTTCCTTACATATTATGG + Intergenic
1191189797 X:57654821-57654843 TTGGTTTTACTTACCCAATAAGG - Intergenic
1191764018 X:64676967-64676989 TTGGAGTTCCTTACACATTTTGG - Intergenic
1193231016 X:79046561-79046583 TTTGAATTCCTTATAAAATCTGG - Intergenic
1193474815 X:81950153-81950175 TGGGCTTTCCTTAAAGAATACGG + Intergenic
1193662128 X:84270214-84270236 TTGCATTTTCTTTGAAAATAAGG - Intergenic
1195169726 X:102254744-102254766 TATGATTTCCTTACAAAATTTGG + Intergenic
1195189131 X:102432356-102432378 TATGATTTCCTTACAAAATTTGG - Intronic
1195828192 X:109025467-109025489 TTGACTTTCATTTCAAAATAAGG + Intergenic
1196488056 X:116237098-116237120 TTGGAATTATTTCCAAAATAGGG + Intergenic
1196740689 X:119023251-119023273 TTGGATTTACATATAAAGTAGGG - Intergenic
1197492567 X:127136884-127136906 TTGGATATCCTAACAAAATATGG + Intergenic
1199325916 X:146498050-146498072 TAGTATTTCATTACACAATAGGG + Intergenic
1201791056 Y:17840835-17840857 TAGGATTTCATTTGAAAATAAGG + Intergenic
1201810498 Y:18065154-18065176 TAGGATTTCATTTGAAAATAAGG - Intergenic