ID: 1076526783

View in Genome Browser
Species Human (GRCh38)
Location 10:131117123-131117145
Sequence CTGTGTTCAGGGTGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 535}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076526771_1076526783 22 Left 1076526771 10:131117078-131117100 CCTCGCAAAGATGGCACATTTGC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1076526783 10:131117123-131117145 CTGTGTTCAGGGTGGGAGGCTGG 0: 1
1: 0
2: 1
3: 50
4: 535
1076526770_1076526783 23 Left 1076526770 10:131117077-131117099 CCCTCGCAAAGATGGCACATTTG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1076526783 10:131117123-131117145 CTGTGTTCAGGGTGGGAGGCTGG 0: 1
1: 0
2: 1
3: 50
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076526783 Original CRISPR CTGTGTTCAGGGTGGGAGGC TGG Intronic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900469982 1:2848984-2849006 CTGTGTCCTGGGTGGGAGTGTGG + Intergenic
900470006 1:2849078-2849100 CTGTGTCCTGGGTGGGAGTGTGG + Intergenic
900470083 1:2849333-2849355 CTGTGTCCTGGGTGGGAGTGTGG + Intergenic
900470101 1:2849396-2849418 CTGTGTCCTGGGTGGGAGTGTGG + Intergenic
901681007 1:10912823-10912845 GTCTGGTCAGGCTGGGAGGCTGG + Intergenic
901785724 1:11623199-11623221 GTGTTCTCAGGGTGGGAGGGGGG - Intergenic
901872266 1:12145055-12145077 CTGTGCCCAGGGAGGCAGGCTGG - Intergenic
902188896 1:14746640-14746662 CTGGGGTCAGGGAGGGAGGGTGG + Intronic
902449996 1:16490920-16490942 CTGTGTCCTGGGTGGGAGAGAGG + Intergenic
902504465 1:16930270-16930292 CTGTGTCCTGGGTGGGAGAGAGG - Exonic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
902878050 1:19352861-19352883 CTGTGTTCTGGCTGGCTGGCAGG + Intronic
903780039 1:25815214-25815236 CGGAGTTCAGGATGGGAGTCCGG + Intronic
903929071 1:26851851-26851873 CAGTCTGCAGGGTGGCAGGCAGG - Intronic
904197487 1:28796637-28796659 CTGACATGAGGGTGGGAGGCTGG + Intergenic
904325381 1:29724471-29724493 CTTTGTTCAGGGTGTGTGGAGGG + Intergenic
904341275 1:29836636-29836658 GTGGGATCAGGGTGGGAGCCTGG - Intergenic
904370719 1:30045948-30045970 CTGGGCTCAGGGATGGAGGCTGG - Intergenic
905352299 1:37356245-37356267 CTGAGGTCAGGTTGGGAAGCGGG - Intergenic
905884817 1:41485916-41485938 CTGTGTGCAGGGTAGGTGTCAGG - Intergenic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906712276 1:47939906-47939928 CTGGATTCAGTGTGGGAGGGAGG - Intronic
906791033 1:48658995-48659017 CAGGGCTCAGGCTGGGAGGCAGG + Intronic
907160347 1:52364884-52364906 CTAGGTTCAGGGTGGGTGGAAGG + Intronic
907473564 1:54690298-54690320 TTGGGGTCAGGGTGGGAGGGAGG + Intronic
907706815 1:56839612-56839634 ATGGGTACAGAGTGGGAGGCTGG + Intergenic
907869923 1:58433647-58433669 CTGTGTGGAGGGGGGGAGGCGGG + Intronic
908607522 1:65815206-65815228 GTGTGTTGAGGGTGGGGGGGAGG - Intronic
911971480 1:104443365-104443387 CTGTGTGAAAGGTGGGAGGGGGG - Intergenic
912476794 1:109943209-109943231 CTGTGTGGTGGGTGGTAGGCAGG - Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912745142 1:112239743-112239765 CTGTGTGCAGGGTGGACCGCAGG + Intergenic
914792097 1:150887154-150887176 CTGAGTTCAGCGTGGGAGTGGGG + Intergenic
914806312 1:150994752-150994774 CTGTGTGCAGGGAGTGAGGGTGG - Intronic
915061574 1:153190192-153190214 CTGTATGAAGGGTGGGAGACAGG - Intergenic
915213457 1:154325924-154325946 CTGCGTACAGGATGGGAGGATGG + Intronic
916179861 1:162073832-162073854 CTGTGTTCAGAGTGGGTACCTGG + Intronic
918783815 1:188737487-188737509 CTGTGTTCAAGCTGGGACACTGG + Intergenic
919237279 1:194861363-194861385 AAGTGTTCAGGGCGGGGGGCGGG - Intergenic
919813194 1:201421826-201421848 GTGTGTGAAGGGTGGGAGGGAGG - Intronic
919919529 1:202160002-202160024 CTCTGTCCAGGGAGGTAGGCTGG + Intronic
920037990 1:203077809-203077831 TTATGTTCAGGGTGGGATGATGG + Exonic
920188662 1:204178539-204178561 CTGCATACATGGTGGGAGGCAGG - Intergenic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920534963 1:206731428-206731450 CTGTGTGGAGGGCTGGAGGCAGG + Intronic
920719769 1:208376149-208376171 CTGTGTTCAGGGTTGGCTGTGGG - Intergenic
920848619 1:209613426-209613448 GTGTGTGCAGAGTGGGAGTCTGG - Exonic
922076232 1:222247614-222247636 CTGCGTTGAGGTTGGGAGGAGGG - Intergenic
922812384 1:228424744-228424766 TTCTGATTAGGGTGGGAGGCTGG - Intergenic
922895626 1:229097765-229097787 CTGTGCTGAGAGCGGGAGGCTGG - Intergenic
923373887 1:233340572-233340594 ATGTGTCCGGGGTGGGAGTCAGG + Intronic
924450463 1:244174317-244174339 TTGGGGTGAGGGTGGGAGGCTGG + Intergenic
1062820095 10:528349-528371 CTGCGTTCTGGGTGGGCAGCGGG - Intronic
1062908153 10:1193057-1193079 AGGTGTTGAGGGTGGAAGGCAGG + Intronic
1062974373 10:1672606-1672628 GTGTGTCCATGGAGGGAGGCAGG - Intronic
1063854395 10:10231560-10231582 ATGTGTTTAGCTTGGGAGGCTGG + Intergenic
1064119011 10:12603374-12603396 CACGGGTCAGGGTGGGAGGCGGG - Intronic
1064146252 10:12828665-12828687 CTGGGTTTATGGTGGGGGGCGGG - Intronic
1067148817 10:43712861-43712883 CTGTGTGCAAGGTGGGATCCTGG - Intergenic
1067228060 10:44388076-44388098 CACAGTTCAAGGTGGGAGGCAGG + Intergenic
1068528336 10:58156614-58156636 CTGTTTTGGGGGTAGGAGGCTGG + Intergenic
1069783836 10:70975377-70975399 CTGGGTCCAGTGTTGGAGGCAGG - Intergenic
1070395528 10:76008602-76008624 GTGTGTACCCGGTGGGAGGCAGG - Intronic
1071525494 10:86355684-86355706 CTGTTTACAGGCTGGGAGGAAGG + Intronic
1071525755 10:86357211-86357233 CTGTTTCCAGGCTGGGAGGGAGG + Intronic
1072111365 10:92323274-92323296 GTGTGGTCAGGGGTGGAGGCTGG - Intronic
1072210667 10:93243949-93243971 CTGTCTTCAAGGTGGGAAACTGG - Intergenic
1072718169 10:97765294-97765316 ATTTGGTCAGGGTAGGAGGCTGG + Intergenic
1072756363 10:98023854-98023876 TTGTGCTCAGGATGGGAGGTAGG - Intronic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1073309833 10:102532480-102532502 CTGTGGTCAGAGTGTCAGGCGGG + Intronic
1073484177 10:103806203-103806225 CTCTGTCCAGGGGGGTAGGCTGG - Intronic
1073519407 10:104112723-104112745 TGGTGTGCAGGGTGGGTGGCAGG + Intergenic
1074551373 10:114445473-114445495 CTGTGTTCAGTTTGTTAGGCTGG + Intronic
1075092776 10:119452830-119452852 CTTTGGTCTGGGTGGGAGGGAGG + Intronic
1075527168 10:123196733-123196755 GTGTGGTCAGGGTGTGTGGCTGG + Intergenic
1075730067 10:124630724-124630746 ATATCTTCAGGGTGGAAGGCTGG + Intronic
1075776933 10:124995220-124995242 CTGTGTTCTGGGCGGGAGGCAGG + Intronic
1076526783 10:131117123-131117145 CTGTGTTCAGGGTGGGAGGCTGG + Intronic
1076612722 10:131736748-131736770 CGGACTTGAGGGTGGGAGGCTGG - Intergenic
1076670847 10:132120424-132120446 CTGTGGTCAGGGGTGGAGGAAGG - Intronic
1076739578 10:132476660-132476682 CTGGGTCCAGGCTGGGACGCTGG + Intergenic
1076820561 10:132936745-132936767 CTCTGTGCTGGGAGGGAGGCAGG + Intronic
1076837004 10:133026144-133026166 ATGTGTTCTGCTTGGGAGGCAGG + Intergenic
1076934880 10:133561120-133561142 CTGTGCCCAGGGTGGCAGGGTGG - Intronic
1077883645 11:6369955-6369977 GTGTGTTCAGGGTGAGAAACAGG - Intergenic
1077920961 11:6641472-6641494 CTGGGGTCAGGCTGGGAGCCTGG - Exonic
1078005075 11:7526536-7526558 CTGGAGTGAGGGTGGGAGGCTGG + Intronic
1078928582 11:15895925-15895947 CTGTGTTCAGGGAGGGAGTGAGG + Intergenic
1079339630 11:19601387-19601409 CTGAGTCCAGGAGGGGAGGCCGG - Intronic
1079803677 11:24902305-24902327 GAGTGTTGAGGGTGGGAGGAGGG - Intronic
1080280649 11:30553021-30553043 CTGTGCTCACCGTGGGTGGCCGG - Intronic
1080737448 11:35030715-35030737 CTGTGTTCCTGGCGAGAGGCTGG + Intergenic
1081264917 11:41008661-41008683 GTGTCTTCAAGGTGGGAGGAAGG - Intronic
1082774522 11:57235272-57235294 CTGTTTTCTGAGTGTGAGGCAGG - Exonic
1082792011 11:57352710-57352732 CTGTGCTCAGGTGGGGAGGGAGG - Intronic
1083380509 11:62264540-62264562 CTGTGCACTGGGTGTGAGGCTGG + Intergenic
1083640296 11:64141769-64141791 CTGGGCACAGGGTAGGAGGCAGG + Intronic
1083844122 11:65321246-65321268 CTGTGGGCAGGGTGAGAGCCTGG - Exonic
1083923672 11:65793523-65793545 CTGGGGTGGGGGTGGGAGGCAGG + Intronic
1084012998 11:66363075-66363097 GAGGGTTCAGAGTGGGAGGCGGG - Exonic
1084184449 11:67464295-67464317 CTGTGGTCAGGCTGGTGGGCTGG + Exonic
1084587895 11:70073843-70073865 CTGTCTTGGGGGTGGGGGGCGGG - Intergenic
1084611020 11:70203141-70203163 CTCTTTTCCGGGTGGGAGGTGGG - Exonic
1084771161 11:71343703-71343725 CTGGGTTCCGGGTGGGAGGGAGG - Intergenic
1085313850 11:75531558-75531580 ATGTGCATAGGGTGGGAGGCAGG + Intergenic
1085514927 11:77106363-77106385 CTGTCCTGAGGGTGGGAGGCTGG - Intronic
1087301394 11:96440149-96440171 CTGTGACCAGGATGGTAGGCAGG - Intronic
1087692585 11:101338796-101338818 ATGGGTTCAGGGTAGGAGGAAGG + Intergenic
1088486637 11:110347211-110347233 CTGTTCTAAGGGTGGGAGGAAGG - Intergenic
1088989724 11:114942193-114942215 CTGTATTCAGTGTGAGAGACAGG - Intergenic
1088994294 11:114983013-114983035 CTGTGTCCAGAATGGCAGGCAGG - Intergenic
1089214901 11:116829518-116829540 CTGTGTTCAGGGCTTGGGGCTGG + Intergenic
1089617120 11:119701046-119701068 GTGTGCTCAGGAGGGGAGGCTGG + Intronic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090205272 11:124880336-124880358 CTGTGGTCAGGGTGGCAGGGTGG + Intronic
1090499810 11:127250461-127250483 CTGGGAACAGGGTGTGAGGCAGG + Intergenic
1091723932 12:2832979-2833001 CTGTGTTCATCGTGGGAAGGTGG - Intronic
1091787845 12:3253722-3253744 TTTTATTGAGGGTGGGAGGCTGG + Intronic
1091823251 12:3491735-3491757 CGGTGGTCCGGGTGGGCGGCGGG - Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092076852 12:5681077-5681099 CTGTGTGCAGGTTGTGTGGCAGG - Intronic
1092263187 12:6963170-6963192 CTGTGCGCAGGGTGGCAGGCGGG + Intergenic
1093253703 12:16839695-16839717 CTGGGTGGAGGGTGGGAGGAGGG + Intergenic
1095506611 12:42905471-42905493 CAGCCTTCAGGGTGGGAGGCGGG + Intergenic
1096033496 12:48442514-48442536 CTGTGTTCAGGGCTGGTGGGGGG - Intergenic
1096626333 12:52898421-52898443 CTGGGATGAGGGCGGGAGGCAGG - Intronic
1096630321 12:52922293-52922315 CTGTCTTCAGGGAGAGAGGGAGG - Intronic
1096751092 12:53759272-53759294 CTGGGTAGAGGGTGGGAGGCTGG - Intergenic
1097015365 12:55982436-55982458 CTGTGAACAGGGAGGAAGGCAGG + Intronic
1098571961 12:71997918-71997940 CTGAGTTCAGTGTTGGAGGCTGG + Intronic
1098620635 12:72593663-72593685 CTGTCAGCAGGGTGGGAGGAGGG - Intronic
1098853117 12:75621291-75621313 CTTTGTGTAGGGTAGGAGGCAGG - Intergenic
1099304574 12:80937641-80937663 CTCTGTCCAGGGTGAGCGGCTGG + Exonic
1100219829 12:92492981-92493003 CTGTGTTGGGGTTGGGAGGAGGG + Intergenic
1101402881 12:104403674-104403696 CTGGGTTCTGGGTTGGATGCTGG - Intergenic
1101574364 12:105983805-105983827 CTGTGGTCAGGGAGGGAATCAGG + Intergenic
1101752656 12:107595399-107595421 GTGTATTCAGAGTGGGAAGCAGG + Intronic
1102036147 12:109771533-109771555 CTGTGTCCAGGGCGGGACCCAGG + Intergenic
1102349172 12:112179535-112179557 CTGTGCCCAGGGAGGGAGCCAGG - Intronic
1102611241 12:114114274-114114296 CTGGCTCCATGGTGGGAGGCTGG - Intergenic
1103994350 12:124819551-124819573 CTGGGTTGAGGGTGGGGGTCAGG - Intronic
1104001161 12:124861582-124861604 CTGTGTTCAGGGGACCAGGCGGG - Intronic
1104051486 12:125197145-125197167 GAGGGTGCAGGGTGGGAGGCGGG - Intronic
1104622788 12:130331059-130331081 CTGTGTCCAGGGTGGAGGGTGGG - Intergenic
1104830831 12:131750111-131750133 CTGTGGCCCTGGTGGGAGGCAGG - Intronic
1104948600 12:132428579-132428601 CTGTGCCCCGGGTGGGTGGCTGG - Intergenic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1105726619 13:23169147-23169169 CTGTGCTCTGGGTGGGAAGGGGG - Intergenic
1105794143 13:23834019-23834041 AAGGGGTCAGGGTGGGAGGCAGG - Intronic
1108039361 13:46324908-46324930 CCATGTTCAGTGTGGAAGGCAGG + Intergenic
1109177512 13:59174394-59174416 CTGTGATCAGGCTGGAGGGCAGG - Intergenic
1110324221 13:74195483-74195505 CTCTGTTAAGGTTGGGAGGTAGG + Intergenic
1110454805 13:75679533-75679555 GTGTGTCCAGGGTAGGAGCCAGG - Intronic
1111091447 13:83452699-83452721 GTGAGCTCAGGGAGGGAGGCAGG + Intergenic
1112155439 13:96811930-96811952 ATGTGCTTAGGGTGTGAGGCAGG + Intronic
1113743443 13:112726282-112726304 CTGTGTGCAGGGAGAGGGGCTGG + Intronic
1113888658 13:113725097-113725119 CAGGGTGCAGGCTGGGAGGCCGG + Intronic
1114744750 14:25135395-25135417 CTGAGTTCATGATGGGAGGATGG + Intergenic
1115434745 14:33360008-33360030 ATGTGTTCAGGCTTGGAGCCTGG + Intronic
1115851147 14:37591651-37591673 CCGTGTGCCGGGTGAGAGGCGGG + Exonic
1115899486 14:38129070-38129092 CTGGGTACAGGATGGGGGGCGGG - Intergenic
1118084600 14:62400029-62400051 GTGTGCTTAGGGTGGGAGGTTGG + Intergenic
1118450912 14:65901436-65901458 CTGTGTTCTGGTGGTGAGGCAGG + Intergenic
1118718390 14:68576390-68576412 CTGGGTTGGGGGTGGCAGGCAGG - Intronic
1118807472 14:69250574-69250596 CTGTGTGCAGCTGGGGAGGCAGG + Intergenic
1118968088 14:70607004-70607026 CTGGGTTAAGGGTGTGAGGGAGG - Intergenic
1119145932 14:72314176-72314198 CTGTGTTCGGGGTTGGAAGTTGG + Intronic
1120595725 14:86432946-86432968 ATCTGTGCAGGGTGGGAGGGTGG + Intergenic
1121101672 14:91253908-91253930 CTGTGGTCAGCGTGAAAGGCAGG - Exonic
1121116416 14:91346279-91346301 CTGCCTTCAGGCTGGGGGGCGGG - Intronic
1121173147 14:91870997-91871019 CCTGCTTCAGGGTGGGAGGCAGG + Intronic
1121312713 14:92943795-92943817 CTGTCTGCAGGGTGGGAAACTGG + Intronic
1121711296 14:96040468-96040490 CTGTCTCCAGGGTGTGTGGCAGG + Intronic
1121865581 14:97359593-97359615 GTGCCTTCAGTGTGGGAGGCAGG - Intergenic
1122214616 14:100194614-100194636 CTGTCTTCAAGGTTGGAGGCTGG + Intergenic
1122335976 14:100984255-100984277 GTGTGTTCTGGGTCAGAGGCAGG + Intergenic
1122848064 14:104511459-104511481 CTGGGGTGTGGGTGGGAGGCTGG - Intronic
1122968591 14:105143377-105143399 CTGTGTTCCTGGTGGCTGGCAGG + Intronic
1122972014 14:105156198-105156220 CTGCGTTTAGGGTGGGAGCGGGG - Intronic
1124878946 15:33623704-33623726 TTATGTTGAGGGTGGGAGGTAGG + Intronic
1126466196 15:48963411-48963433 CTGGGGTGAGGGTGGGAGTCGGG - Exonic
1126532674 15:49728131-49728153 ATGAGTTGGGGGTGGGAGGCGGG + Intergenic
1127528090 15:59814008-59814030 CTATGGCCAGGGTGGGAGGGTGG - Intergenic
1128758567 15:70199287-70199309 CAGTGTTCTGGATGGGAGACTGG - Intergenic
1128762639 15:70227925-70227947 CAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1129669183 15:77597743-77597765 GTCTGCTCAGGGAGGGAGGCTGG - Intergenic
1129718134 15:77863626-77863648 CTTAGATCAGGGTGGGAAGCGGG - Intergenic
1129808438 15:78484499-78484521 CTGGATTCTGGGTGGTAGGCTGG + Intronic
1129978634 15:79846118-79846140 TGGAGCTCAGGGTGGGAGGCAGG + Intronic
1130460782 15:84157145-84157167 CTTAGTTCAGGGTGGGAAGCAGG + Intergenic
1130835356 15:87644803-87644825 CTGTGTTAAGGGATGCAGGCAGG - Intergenic
1131360155 15:91783688-91783710 AAGGTTTCAGGGTGGGAGGCAGG - Intergenic
1132194086 15:99897169-99897191 CTGTGGCCAGGGTGGGAGTGGGG - Intergenic
1132263308 15:100444453-100444475 GTGTGATCAGGGTGAGAAGCAGG - Intronic
1132340683 15:101076493-101076515 GTGTGATCAGGGTGAGAAGCAGG - Intronic
1132381303 15:101368570-101368592 CTGTGGTGAGGCTGAGAGGCTGG - Intronic
1132386877 15:101407073-101407095 CCGTGACCAGCGTGGGAGGCTGG + Intronic
1132497972 16:272817-272839 CGGTGTGCAGGGTGAGAGGGCGG + Intronic
1132537718 16:491398-491420 CAGCGTGCAGGGTGGGAGGCGGG - Intronic
1132622371 16:873925-873947 TGGTGCTCAGGGAGGGAGGCTGG + Intronic
1132662974 16:1069760-1069782 CAGCCTTCAGGATGGGAGGCGGG - Intergenic
1132864539 16:2086921-2086943 CTGTGTCCCGGGTTGGTGGCAGG + Intronic
1132934358 16:2473406-2473428 CTGGGTAGAAGGTGGGAGGCTGG - Intronic
1133374546 16:5273588-5273610 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
1134504001 16:14790798-14790820 CTGAGGTCAGGGAGGGAGGCAGG + Intronic
1134562582 16:15223413-15223435 CTGAGTGAAGGTTGGGAGGCTGG - Intergenic
1134576571 16:15338110-15338132 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134725868 16:16418389-16418411 CTGAGGTCAGGGAGGGAGGCAGG + Intergenic
1134923122 16:18135040-18135062 CTGAGTGAAGGTTGGGAGGCTGG - Intergenic
1134941565 16:18293470-18293492 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1136093746 16:27938921-27938943 GTTTGTTCATGTTGGGAGGCTGG - Intronic
1136990280 16:35147691-35147713 CTGGGGTGAGGGTGTGAGGCAGG - Intergenic
1136994884 16:35182608-35182630 CTGGGCTCTGGGTGGCAGGCTGG - Intergenic
1139545531 16:67647967-67647989 CTGTCTTCAGGGTGGGAGCTTGG + Intronic
1140061845 16:71577247-71577269 CTGCTTTGAGGGTGGGAGGTGGG - Intergenic
1140864923 16:79051562-79051584 CTGTGTGCTGGGTGGGTGGGAGG + Intronic
1141798569 16:86291610-86291632 CTGGGTTCACAGTGGGTGGCAGG - Intergenic
1142259254 16:89034922-89034944 CTGTGTTGAGGCCGGGGGGCCGG + Intergenic
1203141176 16_KI270728v1_random:1767805-1767827 CTGTGTTACTGGTGGGAGGAGGG + Intergenic
1142611808 17:1112590-1112612 CTGTCTTGAGGGAGGGAGGGAGG + Intronic
1142806945 17:2376275-2376297 CGGGGCTCAGGGTGGGAGGCGGG + Intronic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143080130 17:4375582-4375604 TGGTGGTCAGGGTGGGTGGCTGG + Intergenic
1144307807 17:13985046-13985068 CTGGGTCCAGAGTGAGAGGCAGG + Intergenic
1144777827 17:17793620-17793642 CTCTGTCCAGGGTGGTGGGCAGG + Exonic
1145840841 17:27993051-27993073 CTGTGATCTGGGTGGGTGGAAGG - Intergenic
1147473978 17:40692186-40692208 TTCTGTTCTGGGTGGGAGGTTGG + Intergenic
1147554004 17:41464759-41464781 CTGTGTTCATCCTGGGAGGAGGG + Intronic
1148772665 17:50076211-50076233 AGGTTTTCAGGGTGGGGGGCGGG + Intronic
1148850132 17:50550613-50550635 GTGTGTCCATGGTGGCAGGCAGG + Intronic
1148909772 17:50935198-50935220 CTGTTTTCACAGTGGGAAGCAGG - Intergenic
1149054511 17:52347031-52347053 CTGTGTGCAAGGTGGGTGGGGGG + Intergenic
1149539558 17:57458771-57458793 CTTTGTTCAAGGTGGGATACAGG + Intronic
1149646764 17:58246663-58246685 CTTTGTTCACGGTGTGAGGTGGG + Intronic
1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG + Intronic
1150229971 17:63544421-63544443 CTGTGGTCAGGGCTGGGGGCTGG + Intronic
1150280240 17:63925866-63925888 CTGTGTTCTGGGGAGGGGGCAGG + Intergenic
1151364375 17:73607563-73607585 CGGTGTTCAGTTTGGGAGGTGGG + Intronic
1151671754 17:75574796-75574818 CTGGGCTCAGCGTGGGCGGCTGG + Intronic
1152583720 17:81180093-81180115 CTGGAGACAGGGTGGGAGGCAGG - Intergenic
1152810300 17:82378691-82378713 CTGTGTTCTGACTTGGAGGCGGG - Intergenic
1153681779 18:7507862-7507884 CTGAAATCAGGGTGGGTGGCAGG + Intergenic
1153837009 18:8972342-8972364 CTGTCCTCAGGGCTGGAGGCTGG + Intergenic
1153953540 18:10076775-10076797 CGGTGGGCAGGATGGGAGGCTGG - Intergenic
1154485185 18:14867126-14867148 TTGTGGTCCGGGTGGGGGGCGGG + Intergenic
1156681449 18:39593710-39593732 CTGTGTTCAATGCGGGTGGCTGG + Intergenic
1157284376 18:46367374-46367396 TTATGTTCAGTGTGGGAGGTAGG + Intronic
1157608239 18:48939662-48939684 CTCAGTTTAGGGTGGGAGGAAGG - Intronic
1157853762 18:51084498-51084520 CTGGGTTGAGGGTGGGGGGTTGG + Exonic
1158932399 18:62334465-62334487 CTCTGTGTAGGGTGGGAGGAGGG + Intronic
1159030556 18:63226255-63226277 ATGGGCTCAGGATGGGAGGCAGG + Intronic
1159456799 18:68669471-68669493 ATGTGGTAATGGTGGGAGGCAGG + Intergenic
1159678364 18:71314860-71314882 CAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1159760243 18:72416796-72416818 CTGTCATGAGGGTGGGAGGAGGG + Intergenic
1159943771 18:74428644-74428666 CTGTGTGGAGGGTCTGAGGCAGG - Intergenic
1160025875 18:75215796-75215818 GTGTGTGCAGGGTGGTAGGAGGG - Intronic
1160625535 18:80201828-80201850 CAGGGTGCTGGGTGGGAGGCGGG - Intronic
1160764334 19:800695-800717 GTTTGTTCAGTGTGGGAGGAGGG + Intronic
1160838696 19:1136764-1136786 CTGCTTTCAGGCAGGGAGGCAGG - Intronic
1160973228 19:1779665-1779687 AAGTGGTCAGGGTGGGGGGCGGG + Exonic
1161153977 19:2722832-2722854 CTGGGGTCAGGGTGGGAGGGAGG - Intronic
1161349778 19:3785280-3785302 CTGTTTTCTGGTTGGTAGGCAGG + Intronic
1161467855 19:4442131-4442153 CCGTGTTGGGGGTGGGAGGAAGG + Intronic
1161596549 19:5153803-5153825 CTGTGGCCAGGCTGGGTGGCTGG + Intergenic
1161606032 19:5215464-5215486 AGGTGATGAGGGTGGGAGGCGGG + Intronic
1162549494 19:11350757-11350779 CTGGGTTCAGGGTGGGATCAGGG + Intronic
1162565141 19:11441806-11441828 CTGTGTACTGGGCAGGAGGCTGG + Intronic
1163046548 19:14647068-14647090 CTCTGTTCAGGGTCGTAGTCAGG - Intronic
1163370199 19:16897273-16897295 GTGTGTTCAGTGCGGGGGGCGGG - Intronic
1163832785 19:19554967-19554989 AGGTGGTCAAGGTGGGAGGCTGG + Intergenic
1164685972 19:30167174-30167196 CCGTGTTCTGGGTGGGTGGGTGG + Intergenic
1164830462 19:31316191-31316213 TTGTTTTCAGGGAGGGAGGCAGG + Intronic
1165167131 19:33864530-33864552 CTGTCTACAGGGTGGAAGCCAGG + Intergenic
1165751658 19:38264259-38264281 CTGGCCTCAGGGTGGGAGGAGGG - Intronic
1166516110 19:43448273-43448295 CTGTTTTTGAGGTGGGAGGCTGG + Intergenic
1166774664 19:45305029-45305051 CTATGTGCAGGGTGGAAGGGAGG + Intronic
1166791573 19:45401973-45401995 CTGTGGTCAGGGTTGGACGGTGG - Intronic
1166848439 19:45745072-45745094 CGGTGTCCAGGGTGGGGTGCGGG + Intronic
1166877128 19:45904049-45904071 CTGTGTGGAGGGTGGGTGGGAGG + Intergenic
1167053482 19:47094620-47094642 CTGTGTTCATGGTGGGATTGGGG - Intronic
1167209318 19:48123103-48123125 CTGGGGACAGGCTGGGAGGCCGG + Intronic
1167419359 19:49394157-49394179 CTGAGTCCAGCCTGGGAGGCTGG + Intronic
1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG + Intronic
1167660665 19:50794316-50794338 CTGCCTTCAGGATGGGAGGAAGG + Intronic
1168060398 19:53888925-53888947 CTGTGTGCAGGGGGAGTGGCAGG - Intronic
1168293486 19:55368441-55368463 CTGGGGACAAGGTGGGAGGCAGG - Intronic
1168498911 19:56876987-56877009 CTGTGTCATGGGTGGGAGGGAGG - Intergenic
1168642492 19:58039469-58039491 CTTTGATAAGGGTGGGTGGCCGG - Intronic
925176537 2:1788487-1788509 CTGTGTTCTGGGAGACAGGCAGG + Intergenic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925416839 2:3676310-3676332 CTGTGATCAGGCTGTCAGGCTGG + Intronic
925911199 2:8574658-8574680 CTGTGTCCAAGGAGGAAGGCGGG + Intergenic
927519555 2:23690606-23690628 CCGGGCTCAGGGTGGGAAGCAGG + Intronic
927577755 2:24213833-24213855 TTGTGATAAGGGTAGGAGGCAGG - Intronic
929467193 2:42155671-42155693 ATAATTTCAGGGTGGGAGGCTGG - Intergenic
929747578 2:44674920-44674942 CCTTTTTCAGGGTGGGAGACAGG - Intronic
929918480 2:46155475-46155497 CTGAGTGCAGGGTGGGAAGTGGG - Intronic
931026136 2:58115183-58115205 GTGTGTTCAGGGTGAGGGACAGG + Intronic
931709327 2:64974642-64974664 CTGTGTGCAGGGTTAGGGGCTGG - Intergenic
932575423 2:72960019-72960041 GTGTGATCAGGGTGGGTGGGGGG - Intronic
932702454 2:74001138-74001160 CTGTGTTCCCAGGGGGAGGCAGG + Intronic
933427084 2:82126772-82126794 ATGGGTTCAGGGTGGGGGGCGGG + Intergenic
933837825 2:86260096-86260118 CTGTTCTCAGGGTGAGAGGAAGG + Intronic
934559159 2:95303405-95303427 CTGTGTTCAGGGGGAGAGGAAGG + Intronic
934761647 2:96860021-96860043 ATGTTTTCAGGGTGGGGGGAGGG - Exonic
934778033 2:96951242-96951264 CTGGGCTCAGGCTGGGAGGAGGG - Intronic
934781150 2:96970506-96970528 CTCTGTTCGTGGTGGGAGTCTGG + Intronic
934952700 2:98589188-98589210 CTGAGTTCACTGTGGCAGGCAGG + Exonic
935676383 2:105598097-105598119 CAGTGCACAGAGTGGGAGGCAGG - Intergenic
936165293 2:110115424-110115446 CTGTGCGCCCGGTGGGAGGCTGG + Intronic
937765558 2:125656760-125656782 GTGTGTTCAATGTGGGAGGTAGG - Intergenic
937914123 2:127090589-127090611 AGGTGATGAGGGTGGGAGGCGGG - Intronic
937922091 2:127137932-127137954 CCAAGTTCAGGGTGGGACGCAGG + Intergenic
937981765 2:127619945-127619967 CTGCATTCAGGGAGGGAGGTGGG + Intronic
938087105 2:128408833-128408855 CTGTGGTTAGGGTGGGCGGCGGG + Intergenic
938392732 2:130917636-130917658 CTGTGTTCACTGGGGGAGGGGGG - Intronic
939620298 2:144410684-144410706 CTGTGTTCACAGTGGAAGACAGG + Intronic
940048381 2:149434725-149434747 CTGTGGCCAGGGTCTGAGGCAGG + Intronic
940398202 2:153218084-153218106 TTGTGTTTAGGATGGGAGCCAGG + Intergenic
941112730 2:161434211-161434233 GTGTGTGCATGGTGGGAGGCAGG - Intronic
942289869 2:174458098-174458120 ATGTACTCGGGGTGGGAGGCAGG + Intronic
944301723 2:198131307-198131329 CTCTGTTGAAGATGGGAGGCAGG - Intronic
944875857 2:203963678-203963700 GTGTGATCAGGGTGAGAGACAGG + Intergenic
946187672 2:217990345-217990367 GTGTGTTGAGGGTGTGTGGCTGG - Intronic
946187681 2:217990402-217990424 TTGTGGTCAGGGTGTGTGGCTGG - Intronic
947390306 2:229632559-229632581 TTTTGTGCAGGATGGGAGGCTGG + Intronic
947573114 2:231250758-231250780 CTGTGTTGAGTGTGGAAGGAGGG + Intronic
947839192 2:233196845-233196867 CTGTGTACAGCGGGGGTGGCTGG - Intronic
948389403 2:237601261-237601283 CTCTGTGCAGGGTGAGAGGATGG - Intronic
948496951 2:238356715-238356737 CTGTTTGCAGACTGGGAGGCTGG + Intronic
948607765 2:239146877-239146899 AGGTGTGCAGGCTGGGAGGCAGG - Intronic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
949076597 2:242063043-242063065 CATTGTCTAGGGTGGGAGGCAGG + Intergenic
1168803719 20:660905-660927 CTGAGTTGAGGGTAGGTGGCAGG + Intronic
1168910165 20:1440950-1440972 CTGTGTTGAGGGTGTGTGGCTGG - Intergenic
1169694182 20:8368862-8368884 GTGTGATCGGGGTGGGAGGGTGG - Intronic
1170552832 20:17491801-17491823 GTGAGGTGAGGGTGGGAGGCAGG - Intergenic
1171036986 20:21721956-21721978 CTGAGGTCAAGGTGGGAGGATGG - Intergenic
1171333782 20:24364533-24364555 CTTTGTTGAGGGAGGGAGGGTGG + Intergenic
1171534408 20:25873487-25873509 ATGTGTTCAGGGAGGGAACCAGG + Intergenic
1172347577 20:34215984-34216006 TGGAGTTCAGGCTGGGAGGCGGG - Intronic
1172811194 20:37649526-37649548 CTTTGATCTGGGTGGGAAGCAGG + Intergenic
1173290724 20:41712685-41712707 CTGTGTTTAGGGAAGCAGGCTGG - Intergenic
1173360273 20:42337965-42337987 CTCTGTTCAGGTCTGGAGGCTGG - Intronic
1173648116 20:44646211-44646233 CTGTGTTCACACAGGGAGGCAGG - Intronic
1174914827 20:54643595-54643617 CTGTGTCCAGGGTGTGGGCCAGG + Intronic
1175211237 20:57357426-57357448 CTATGTTTGGGGTGGGATGCTGG + Intronic
1175815023 20:61878779-61878801 CTGTGTGCAAGGCGGGAGACAGG - Intronic
1175831323 20:61966642-61966664 CTGTTTTCATGGTTGGGGGCAGG - Intronic
1176139222 20:63537817-63537839 CTGTGCTCAGGGGTGGAGTCTGG - Intergenic
1176203690 20:63876753-63876775 CTGGTGTCACGGTGGGAGGCTGG + Intronic
1178300695 21:31450424-31450446 CTCGGATCTGGGTGGGAGGCAGG - Intronic
1178409822 21:32353865-32353887 GTCTGTGCAGGGTGGGAGGTGGG - Intronic
1178493266 21:33067719-33067741 CTGTGTGCAGGGGAGGAAGCCGG + Intergenic
1179105817 21:38399502-38399524 TTGTGTTCAGGGTGGTGGGATGG - Intronic
1179605967 21:42515093-42515115 CTTTGTTGGGGGTTGGAGGCAGG + Intronic
1179810822 21:43868143-43868165 CTGTGTTTAGTTTTGGAGGCGGG + Intronic
1180009648 21:45040869-45040891 CTGACCTCGGGGTGGGAGGCCGG + Intergenic
1180104348 21:45608066-45608088 TTGACTTCAGGGTGGGTGGCGGG + Intergenic
1180305076 22:11067197-11067219 TTGTGGTCCGGGTGGGGGGCGGG + Intergenic
1180847163 22:18990049-18990071 ATGTGATCAGGGTTGGAGGTGGG - Intergenic
1181083188 22:20427317-20427339 CTGTGTTCTGGGTGGGACACAGG - Intronic
1181486899 22:23237285-23237307 CTGTGCTCATGGAGGCAGGCTGG + Intronic
1181760397 22:25054454-25054476 GTGTATGCAGGGTGGGAGGTGGG + Intronic
1181916361 22:26284020-26284042 CTGTGTTCATGATGGCTGGCAGG + Intronic
1183383650 22:37502984-37503006 CTGGGCTCGGGGTGAGAGGCTGG + Intronic
1183520592 22:38294295-38294317 CTGGGTTCAGGGTGGGTGGGGGG - Intronic
1183596986 22:38818735-38818757 CGGGGGTCAGGGTGGGAGGTGGG + Exonic
1183715283 22:39529716-39529738 CTGAGCATAGGGTGGGAGGCTGG - Intronic
1183856220 22:40636730-40636752 CAGTCTTCAGGACGGGAGGCGGG - Intergenic
1184155640 22:42665009-42665031 CTGTGTACAGGGAGGCAGCCTGG - Intergenic
1184301241 22:43562500-43562522 CTGGGTTGGGGGTGGGAGGGAGG + Intronic
1184465797 22:44668507-44668529 CAGTGCTCAGGGGCGGAGGCCGG + Intergenic
1184594112 22:45503685-45503707 CTCTGTCCCGGGAGGGAGGCAGG - Intronic
1184659843 22:45960694-45960716 CTGTGATCAGCCAGGGAGGCGGG + Intronic
1184742998 22:46439924-46439946 CTGTGTGAGGGGTGGGAGGGCGG - Intronic
1184880786 22:47303120-47303142 CTGAGTAGAGGGTGGGAGGCTGG + Intergenic
1185287363 22:50008548-50008570 CTTTGTCCACCGTGGGAGGCAGG - Intronic
1185294554 22:50046781-50046803 CTTTGTGCAGGGCTGGAGGCCGG + Intronic
1185309416 22:50145907-50145929 CAGTGCTCAGGGAGGGAGGCAGG + Intronic
1185332340 22:50257415-50257437 CAGTCCTCAGGGTGGGAGGGGGG - Intronic
950355630 3:12406097-12406119 CTGTCTTCATTGGGGGAGGCGGG + Intronic
950752883 3:15144834-15144856 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
952078665 3:29730296-29730318 CTGTGTTCTGGGCGGGGGGCGGG + Intronic
953022654 3:39125546-39125568 CTGTCTTCATGGTGGGGGTCTGG + Intronic
953915070 3:46913892-46913914 CTGTGGACAGGGTTGGAGCCAGG + Intergenic
954147377 3:48641019-48641041 CTGGGATCTGGGTGGGGGGCAGG + Intronic
954297079 3:49680245-49680267 CTGTGTGCAGGGTGGCAGCTGGG - Intronic
954431669 3:50473991-50474013 CCGTGCTCAGCGTGGCAGGCAGG - Intronic
954750532 3:52811025-52811047 ATGTGAACAGGTTGGGAGGCAGG + Intergenic
954876245 3:53804875-53804897 CTGTGTCCAAGGGAGGAGGCGGG + Intronic
955429383 3:58826885-58826907 TTCTGTTCAGGGTGGGATGAGGG + Intronic
955508462 3:59655445-59655467 CTGTGTTCTGGGTGAGAGTGAGG - Intergenic
956966827 3:74471187-74471209 GCCTGTGCAGGGTGGGAGGCTGG + Intronic
960052663 3:113252832-113252854 GAGTGCTCAGGGAGGGAGGCAGG + Intronic
961089198 3:124094822-124094844 ATGAGTTCAGGGTGGGATGACGG + Exonic
961186417 3:124918889-124918911 CAGTTTTCATGGTGGGAGGCTGG - Intronic
961285428 3:125798554-125798576 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
961293769 3:125867757-125867779 GTGTGATCAGGGTGAGAAGCAGG - Intergenic
963058914 3:141209112-141209134 GTGTGTTCAGGGTGAGAAACAGG - Intergenic
963601656 3:147384283-147384305 GTCAGTTCAGGGTTGGAGGCGGG + Intergenic
965624575 3:170673910-170673932 CTGTGATCAGGGTGAGAAACAGG + Intronic
965639721 3:170819343-170819365 CTGTGATCAGGGTGAGAAACAGG + Intronic
966235317 3:177694988-177695010 CTGTGATCAGGGAGGAATGCAGG - Intergenic
966501400 3:180645362-180645384 CTGGGTTCTGGGTGGGAAGAGGG - Intronic
967661146 3:192112015-192112037 CTATGTTCAAGGTGTGATGCTGG + Intergenic
967972411 3:195009030-195009052 CTCTGCTCAGGGTGGGATGCTGG + Intergenic
968058059 3:195708229-195708251 CTGTGGTCTGGGTGGCAGTCTGG - Intergenic
968615719 4:1576972-1576994 CAGTGTGCAGTGTGGGAGGGAGG - Intergenic
968711989 4:2126053-2126075 CTGCATACTGGGTGGGAGGCAGG + Intronic
968737687 4:2305734-2305756 CGGTGTTCAAGGTGGCCGGCTGG + Intronic
969133562 4:5011376-5011398 CTGTTGTCCAGGTGGGAGGCTGG + Intergenic
969225157 4:5791779-5791801 CTGTGTTCAGGTATGGTGGCAGG - Intronic
969499174 4:7542809-7542831 ATTTGCTCAGGGTGGGTGGCTGG + Intronic
969517595 4:7656297-7656319 CTGAGGGCAGGGTGGGGGGCGGG - Intronic
969599892 4:8170104-8170126 CTGGGTTCAGGGTAGGAGGGTGG + Intergenic
969716370 4:8870215-8870237 CTGTGTTGGGGGTGGGGGGCTGG + Intronic
973651862 4:53004747-53004769 CTGTCTTCAGGGTGTCAGGGTGG - Intronic
973792864 4:54394633-54394655 CACTGTTCAGAGAGGGAGGCAGG - Intergenic
974514970 4:62897213-62897235 ATGAGTTCAGGGAAGGAGGCTGG + Intergenic
976441136 4:85076075-85076097 CTGTGTGTTGGGTGGGGGGCAGG - Intergenic
977635994 4:99299238-99299260 CAGTGATAAGGGTGGGAGGGAGG + Intergenic
979301871 4:119095685-119095707 TTTTGTTCGGGGTGGGAGGTGGG - Intergenic
980652672 4:135740032-135740054 CTGTCAGCAGTGTGGGAGGCGGG - Intergenic
982443458 4:155462873-155462895 CTATGTTTGGGGTGGGATGCTGG + Intergenic
984052160 4:174877756-174877778 CTATGTACATTGTGGGAGGCAGG + Intronic
985535587 5:464112-464134 CTGCGTGCAGCGTGGGAGGGAGG - Intronic
985535597 5:464164-464186 CTGCGTGCAGTGTGGGAGGGAGG - Intronic
985650037 5:1103136-1103158 CAGTGTTCAGGCTGGGACACGGG + Intronic
986122717 5:4857178-4857200 GGTTGTTCAGGGTTGGAGGCTGG - Intergenic
986243042 5:5978712-5978734 CTGTATCACGGGTGGGAGGCTGG - Intergenic
986259736 5:6133934-6133956 CTGTGTTCAAAGTGGCAGGAGGG + Intergenic
986684590 5:10265346-10265368 CTGTGTTCAGGGTGGGGCCGGGG - Exonic
986706746 5:10459316-10459338 CAGTGATGAGGGTGGAAGGCGGG - Intronic
986706754 5:10459343-10459365 CAGTGATGAGGGTGGAAGGCAGG - Intronic
987130807 5:14858256-14858278 CTGGGGGAAGGGTGGGAGGCGGG - Intronic
987394774 5:17412872-17412894 CTTGCTTCAAGGTGGGAGGCTGG + Intergenic
988686764 5:33532903-33532925 TAGTGGTCAGGGTGGGTGGCTGG + Intronic
992029718 5:72709195-72709217 GTGAGCTCAGGGAGGGAGGCTGG - Intergenic
994236163 5:97365551-97365573 CTGTGTTCAGAGTGGGAACAGGG + Intergenic
994997587 5:107083693-107083715 ATGAATTCAGGGTGGCAGGCAGG - Intergenic
995695794 5:114876813-114876835 CTGTTTTCAGAGTGTCAGGCAGG - Intergenic
996052344 5:118948504-118948526 CTGTGATCAGGGTGGGGAACAGG + Intronic
996176706 5:120368402-120368424 ATGAGCTCAGGGAGGGAGGCTGG + Intergenic
998474554 5:142409366-142409388 CTGTGCTCACGGAGAGAGGCAGG + Intergenic
998498732 5:142613892-142613914 CTGTAGTCAAGGTGGGAGGAAGG - Intronic
998870941 5:146551002-146551024 CTGTGTTCATGCTGTGGGGCTGG + Intergenic
998919651 5:147054004-147054026 CAGATTTCAGGGTGGGAGGGTGG - Intronic
999126131 5:149247568-149247590 CTGTGGTCTGGGTGGGGGTCTGG - Intronic
999828968 5:155300991-155301013 AAGTGTACAGGGTGGGAGGAGGG - Intergenic
1001007443 5:168065920-168065942 ATGTTTCCAGGGTGGGAGTCGGG - Intronic
1001099161 5:168799964-168799986 GTGGCTTCTGGGTGGGAGGCAGG - Intronic
1001538261 5:172515241-172515263 GTGTGTTCTGGGTGGGTGGGGGG - Intergenic
1001961060 5:175880560-175880582 CTGGGATCTGGGTGGGAGGCTGG + Exonic
1002518736 5:179778251-179778273 CTGGCTGCAGGATGGGAGGCTGG + Intronic
1003098130 6:3157716-3157738 CTGGGTCTAGGGTGGGCGGCCGG + Intergenic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003735934 6:8877760-8877782 CTGGGTTCAGGGTGCCAGACTGG + Intergenic
1004078991 6:12372238-12372260 GTGAGTTCAGGTTGGGAAGCTGG + Intergenic
1005957798 6:30676784-30676806 CTGTGGTCAAGGGAGGAGGCAGG + Exonic
1006810503 6:36817565-36817587 TGGTGTTCAGGATGTGAGGCTGG - Intronic
1007235984 6:40391896-40391918 CTGTGCGCAGGGTGGGAGAAGGG - Exonic
1007424676 6:41739329-41739351 CTGTGTGCAGGATGGGGGCCTGG - Intronic
1007503730 6:42318282-42318304 CTGTATTCAGTGTTGGGGGCTGG - Intronic
1008840976 6:55904007-55904029 CTTTTTTCAAGGTGGGAGGGGGG + Intergenic
1010972268 6:82275561-82275583 CTCTGTCCAGAGTGGGAGGAGGG - Intergenic
1011493377 6:87915352-87915374 GTGTGTGGAGGGTGGGAGGTGGG + Intergenic
1012854008 6:104479746-104479768 CTGGGTTCTGGGTTGGAGTCTGG - Intergenic
1014406031 6:121052347-121052369 CTGTGTTCATGGAGGGAGACAGG - Intergenic
1015483516 6:133742209-133742231 CTGTGCTGAGGGTGAGAGGCAGG + Intergenic
1016995859 6:149962187-149962209 CTGACTTCAGGGAGGGTGGCAGG + Intergenic
1017002720 6:150006981-150007003 CTGACTTCAGGGAGGGCGGCAGG - Intergenic
1017877936 6:158538934-158538956 CTGTGGTCAGAGAGAGAGGCTGG + Intronic
1018037053 6:159890423-159890445 GTGTGTTCAGGGGTGAAGGCAGG - Intergenic
1018570433 6:165204137-165204159 ATGTGTTGAGGGAGGGAGGGAGG - Intergenic
1018741558 6:166732966-166732988 TGGGGTGCAGGGTGGGAGGCAGG + Intronic
1019480702 7:1265377-1265399 ATGTGGTCAGGGAGGGCGGCAGG + Intergenic
1019494821 7:1332786-1332808 CCGTGTTCTCGGTGGGAGTCAGG - Intergenic
1019641517 7:2106132-2106154 CTGTGCTGGGGGTGGGAGGCGGG - Intronic
1019642322 7:2110592-2110614 CTGTGTTGAGGATGGGAAGGAGG - Intronic
1019878615 7:3838650-3838672 CTGTGTTCAGGGACGGGGGCTGG - Intronic
1020142931 7:5622401-5622423 CATTGCTCAGGGTGGGGGGCTGG - Intronic
1021809613 7:24390603-24390625 CTGCATTCAGGGTGGGAAGAGGG - Intergenic
1023158500 7:37275275-37275297 CTGGGTGCTGGGTGGGAGGAGGG + Intronic
1023413149 7:39908092-39908114 TTGTGTATAGGGTGGGAGGTGGG - Intergenic
1023849162 7:44140680-44140702 CAGTGCGCAGGGTGGGAGGTGGG + Intronic
1023984696 7:45087997-45088019 CTCTGCTCTAGGTGGGAGGCAGG - Intronic
1024656819 7:51458053-51458075 CGGAGTTTAGGGTGGGAGTCGGG - Intergenic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1025927460 7:65971203-65971225 CGGAGTGCAGGCTGGGAGGCAGG + Intronic
1026535890 7:71238268-71238290 CTGGTTCCAGGGTGGGAGGCAGG + Intronic
1026883053 7:73919753-73919775 CTGGGGCCAGGGTGGAAGGCAGG - Intergenic
1027229745 7:76265270-76265292 CTGGGATCCTGGTGGGAGGCTGG + Intronic
1028163519 7:87512007-87512029 CAGTTTTCTGGGTGGGAGGGAGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1030624140 7:111825382-111825404 CTGTATTTTGGGTGGGAGGGAGG - Intronic
1031330298 7:120455810-120455832 CAGGGTTAAGGGTGGGAGGAAGG + Intronic
1032017948 7:128391824-128391846 CGGGGTTGAGGCTGGGAGGCAGG + Intergenic
1032074050 7:128827903-128827925 CTCTGTTCAGGTGGAGAGGCCGG - Intergenic
1032090397 7:128908904-128908926 CCGTGCTCAGGGTTGGGGGCGGG - Intronic
1032202063 7:129829119-129829141 CTTGGTTCTGGGTGGGAAGCGGG + Intergenic
1032331754 7:130987023-130987045 GTGTGTTGGGGGTGGGAGGTGGG + Intergenic
1033326873 7:140386872-140386894 CCATGTTCAGGGTGGTATGCAGG + Intronic
1035015771 7:155764520-155764542 CTGAGCTCAGGCTGTGAGGCAGG + Intronic
1035299554 7:157887970-157887992 CTCTGCCAAGGGTGGGAGGCAGG - Intronic
1037106044 8:15110193-15110215 CTGTCTTTAGGGAGGGAGGTAGG + Intronic
1038391973 8:27210278-27210300 CTATGTTCAGGTTGCCAGGCTGG - Intergenic
1038495192 8:27996499-27996521 CTGTGCTCAGGGTGAGACCCAGG - Intergenic
1038612649 8:29069962-29069984 CTGGGACCAGGGTGGGAGGCTGG + Exonic
1038612669 8:29070014-29070036 CTGGGACCAGGGTGGGAGGCTGG + Exonic
1038762706 8:30399500-30399522 CTGTGTTGAGGGTAAGGGGCTGG + Intronic
1040109162 8:43558656-43558678 ATGTGTTCAGGATGTGTGGCAGG - Intergenic
1040876134 8:52154497-52154519 TGGTGATCAGGGTGGGAGGAGGG + Intronic
1040913585 8:52545500-52545522 GTGTGTGCAGGGAGGGAGGTGGG - Intronic
1041437437 8:57858128-57858150 CTGGGAGCAGGGAGGGAGGCAGG + Intergenic
1041511519 8:58659388-58659410 CTGAGGTCGGGGTGAGAGGCCGG - Exonic
1041651552 8:60308043-60308065 GTGTGATCAGGGTGAGGGGCAGG + Intergenic
1041839237 8:62249247-62249269 CGGTGGGGAGGGTGGGAGGCGGG - Intronic
1042291636 8:67174989-67175011 CTGTGTTCTGGGTGGCATCCTGG + Intronic
1042437374 8:68783203-68783225 CTTTGAACAGAGTGGGAGGCAGG - Intronic
1042864507 8:73345517-73345539 ATGTGTTAGGGGTGGGAGGAGGG - Intergenic
1044592662 8:93929384-93929406 CAGTGTTCACGCTGGAAGGCTGG - Intergenic
1049062937 8:140290229-140290251 TGGTGTTCAGGGTAAGAGGCGGG - Intronic
1049097984 8:140560129-140560151 CTGTGGTCAGGGGCTGAGGCGGG - Intronic
1049208993 8:141376707-141376729 CTGAGAGCAGGGTGGGGGGCGGG - Intergenic
1049237037 8:141517607-141517629 CTGTGTCCAGGCTGCGAGCCAGG + Intronic
1049305382 8:141900042-141900064 CTGTGAGCAGGATGAGAGGCCGG + Intergenic
1049453928 8:142677535-142677557 CTGTGTTCAAGGTGCCAGCCTGG - Intronic
1050257802 9:3812716-3812738 GTGTGATCAGGGTGAGAAGCAGG + Intergenic
1050353421 9:4761495-4761517 CTGAGAGCAGTGTGGGAGGCTGG - Intergenic
1052067033 9:24034660-24034682 CTATGTCCAGGGAGGGAGGAAGG + Intergenic
1052733433 9:32316133-32316155 CTGTTTTCAGGATGATAGGCTGG + Intergenic
1053470093 9:38340200-38340222 CTTAGCTCAGGGTGGGAGGGAGG - Intergenic
1053659528 9:40258005-40258027 CTGTGTTCAGGGAGTGAGTGGGG + Intronic
1053886105 9:42645987-42646009 TTGTGGTCCGGGTGGGGGGCAGG + Intergenic
1054225127 9:62453436-62453458 TTGTGGTCCGGGTGGGGGGCAGG + Intergenic
1054525070 9:66118212-66118234 CTGTGTTCAGGGAGTGAGTGGGG - Intronic
1055611467 9:78030454-78030476 CTGTGTACTGGGGGCGAGGCGGG - Intronic
1056383235 9:86074572-86074594 CAGTGTGCAGGGGTGGAGGCTGG + Intronic
1056404687 9:86262358-86262380 CTCAGTGCAGGCTGGGAGGCTGG - Intergenic
1060194691 9:121616131-121616153 CAGGGATCAGGGTGGGAGGAAGG - Intronic
1060270224 9:122134971-122134993 CTGTGTCCAGGCTTGGAAGCTGG + Intergenic
1060410141 9:123394821-123394843 CTGTCCTCAGGGTGAGGGGCAGG - Intronic
1060756701 9:126219208-126219230 GTGTGTGCAGGCTTGGAGGCAGG - Intergenic
1060764223 9:126281862-126281884 CTGGGGTCAGCCTGGGAGGCAGG - Intergenic
1060776188 9:126376592-126376614 CAGTGTTCAGGGGAGGCGGCTGG + Intronic
1061235012 9:129337114-129337136 GTGTGTTCCTGGTGGGAGTCGGG + Intergenic
1061987813 9:134140316-134140338 CAGTGTTCGGGGTCGGAGGGTGG + Intronic
1062243631 9:135552474-135552496 CTGTGTCCAGGGTCGGGGGAGGG - Intergenic
1062302907 9:135885469-135885491 CTCTGTGCAGAGTGGGAGACGGG + Intronic
1062373613 9:136252410-136252432 CGGTGGACAGGGTGGGCGGCCGG - Intergenic
1062388759 9:136325880-136325902 CTGGGTTAGTGGTGGGAGGCTGG - Intergenic
1062538219 9:137030198-137030220 CTGGGCTCAGGGAGGGAGGGCGG - Exonic
1062598230 9:137308604-137308626 CCAAGTTCAGGGTGGGAGGACGG - Intronic
1185702956 X:2245133-2245155 CTTTGAACAGAGTGGGAGGCAGG - Intronic
1186157189 X:6737775-6737797 CTGTTTCCAGGTTGGGAGGTTGG + Intergenic
1186835171 X:13430370-13430392 CTGTCTCCAGCATGGGAGGCAGG + Intergenic
1188593808 X:31872085-31872107 CTGTGTTCAAGGTGGGGGGAGGG - Intronic
1188644892 X:32553775-32553797 CTGTCTTCAGTGTTGGAGGAAGG + Intronic
1189015288 X:37090739-37090761 CTGTGTTGAGGGTAAGGGGCTGG + Intergenic
1190030231 X:46965290-46965312 TTCTGTTCAGAGTGGCAGGCAGG + Intronic
1190064149 X:47229044-47229066 CTGGCCTCAGTGTGGGAGGCTGG - Exonic
1190333424 X:49249252-49249274 TTGTGTTCAAGGTGTGGGGCAGG + Exonic
1190448115 X:50551202-50551224 TGATGTTGAGGGTGGGAGGCAGG - Intergenic
1190748218 X:53339246-53339268 ATCTGGTCAGGGTGGGAGGATGG + Intergenic
1190798894 X:53770454-53770476 ATCTGGTCAGGGTGGGAGGATGG + Intergenic
1191121179 X:56907067-56907089 CTGTTGTGGGGGTGGGAGGCTGG - Intergenic
1191670064 X:63740726-63740748 CTGAGTGAAGGGTGGGAAGCAGG - Intronic
1191684888 X:63879531-63879553 CTGTGGTCATGGTGGCAGGTTGG - Intergenic
1192176406 X:68888641-68888663 ATGTGGTCAGAGAGGGAGGCAGG + Intergenic
1192583708 X:72304833-72304855 CTGGGGTCAGGGTGGGTGGTGGG - Intronic
1194995421 X:100586781-100586803 CTGTGTTCAGGCTGGCAGGGTGG + Intronic
1196048087 X:111276930-111276952 CTGTGTTGCGGGAGGGAGGTGGG + Intergenic
1196107737 X:111914458-111914480 CTGCGTGCAAGGTGGGAGGGAGG - Intronic
1196397206 X:115277038-115277060 CTGTCGTCAGGCTGGAAGGCAGG - Intergenic
1196401636 X:115323234-115323256 TAGTGTGCAGGGTGGGAGGAGGG + Intergenic
1196421686 X:115528722-115528744 CTGTGTGCAGGGGTGGGGGCGGG + Intergenic
1199377645 X:147132686-147132708 GTGTGTTCAGGGTGAGGGACAGG + Intergenic
1199683082 X:150240843-150240865 CTGTGCACATGGTGGGAGGGAGG + Intergenic
1199868610 X:151876545-151876567 CTTTGAACAGGATGGGAGGCAGG - Intergenic
1200219231 X:154382903-154382925 CTGTGCCAAGTGTGGGAGGCTGG - Intergenic
1201898105 Y:19015753-19015775 CTGTGTTCAGGTTGGAACACTGG - Intergenic
1202378467 Y:24258035-24258057 CTTAGTTCAGGGTGGGAAGCAGG - Intergenic
1202492315 Y:25412086-25412108 CTTAGTTCAGGGTGGGAAGCAGG + Intergenic