ID: 1076531526

View in Genome Browser
Species Human (GRCh38)
Location 10:131148173-131148195
Sequence CAGGCTATTCCCCCATCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 176}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076531526_1076531539 28 Left 1076531526 10:131148173-131148195 CCCTGAGATGGGGGAATAGCCTG 0: 1
1: 0
2: 0
3: 28
4: 176
Right 1076531539 10:131148224-131148246 CAAGGGTCCTTCTAAGAGGGAGG No data
1076531526_1076531538 25 Left 1076531526 10:131148173-131148195 CCCTGAGATGGGGGAATAGCCTG 0: 1
1: 0
2: 0
3: 28
4: 176
Right 1076531538 10:131148221-131148243 TCACAAGGGTCCTTCTAAGAGGG No data
1076531526_1076531532 10 Left 1076531526 10:131148173-131148195 CCCTGAGATGGGGGAATAGCCTG 0: 1
1: 0
2: 0
3: 28
4: 176
Right 1076531532 10:131148206-131148228 TGGCCCCAAATGTAATCACAAGG No data
1076531526_1076531533 11 Left 1076531526 10:131148173-131148195 CCCTGAGATGGGGGAATAGCCTG 0: 1
1: 0
2: 0
3: 28
4: 176
Right 1076531533 10:131148207-131148229 GGCCCCAAATGTAATCACAAGGG No data
1076531526_1076531537 24 Left 1076531526 10:131148173-131148195 CCCTGAGATGGGGGAATAGCCTG 0: 1
1: 0
2: 0
3: 28
4: 176
Right 1076531537 10:131148220-131148242 ATCACAAGGGTCCTTCTAAGAGG No data
1076531526_1076531530 -10 Left 1076531526 10:131148173-131148195 CCCTGAGATGGGGGAATAGCCTG 0: 1
1: 0
2: 0
3: 28
4: 176
Right 1076531530 10:131148186-131148208 GAATAGCCTGGTCATTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076531526 Original CRISPR CAGGCTATTCCCCCATCTCA GGG (reversed) Intronic
901645972 1:10716952-10716974 CAAACTTCTCCCCCATCTCAAGG + Intronic
903812240 1:26041219-26041241 CAGGCCTTTCCTACATCTCAGGG - Intronic
904468904 1:30723738-30723760 CAGGCTCTCCCGCCCTCTCAGGG - Intergenic
907592170 1:55685720-55685742 CAGGCGTTTTCCCCATCTCTGGG + Intergenic
908123752 1:61009733-61009755 CAGGATATTCCACCATGCCAAGG + Intronic
912465617 1:109871448-109871470 CAGGATACTCTCCCATCTCAAGG - Intergenic
916714591 1:167438569-167438591 CCGGCTTTCCCCCCATCTCAGGG + Exonic
920036970 1:203072420-203072442 CAGGGTCTTCCCTCAACTCAAGG - Intronic
920728794 1:208463094-208463116 CATGCTCTTCCCCCATTACAGGG - Intergenic
922030244 1:221790531-221790553 CAGGATATTCCCCCAGCTATGGG - Intergenic
924446082 1:244132854-244132876 CAGGATCATCCCCCATCTCCAGG - Intergenic
1064404286 10:15047342-15047364 CAGGCTCTTCCTCCATCCCAGGG + Intronic
1066114105 10:32224643-32224665 CAGGATAATCTCCCATCTCAAGG - Intergenic
1066540566 10:36442164-36442186 CTGATTATTCCCCCAACTCATGG - Intergenic
1067341894 10:45412401-45412423 TAGGCTGTTCCCCCAACCCAAGG - Intronic
1069752100 10:70751475-70751497 CAGGCTCTCCCCCCAACTGAGGG + Exonic
1070633287 10:78103873-78103895 CAGGATAATCCCCTGTCTCAAGG - Intergenic
1071182962 10:83008011-83008033 AAGGATATTCCCACTTCTCAGGG - Intergenic
1072085821 10:92078094-92078116 CAGGCTTCTCACCAATCTCATGG + Intronic
1072169576 10:92846831-92846853 CAGGATAATCTTCCATCTCAGGG - Intronic
1074670737 10:115787799-115787821 CAGTGTAATCTCCCATCTCAAGG - Intronic
1075280661 10:121135564-121135586 CAGGCTATCAACCCATCTCGAGG + Intergenic
1075393823 10:122112960-122112982 CAGGCTCCTCCCCCAGCTCTGGG - Intronic
1075522700 10:123153603-123153625 CAGGCTGTTCACCCTTCTGAAGG + Intergenic
1076531526 10:131148173-131148195 CAGGCTATTCCCCCATCTCAGGG - Intronic
1078466770 11:11555775-11555797 CAGGCTATTCCACCTGGTCATGG - Intronic
1078993203 11:16670065-16670087 CAGGCAAGGCCCCCAACTCATGG + Intronic
1082866253 11:57902465-57902487 CAGGCTCTTCCTCCAGCTCTGGG - Intergenic
1083083529 11:60118510-60118532 CAGGCTCTTACCCCATCTACTGG - Intergenic
1084474378 11:69380612-69380634 CAGGCCAATCCCCCACCTCCTGG + Intergenic
1085347861 11:75779814-75779836 GAGGCTCATCCCCCATCTCTGGG + Intronic
1091277583 11:134362805-134362827 CAGGGCATCCTCCCATCTCATGG + Intronic
1091722268 12:2821863-2821885 CAGGCTATTCTCACATCCCAGGG + Intronic
1092928958 12:13297216-13297238 CAGGATAATCTCCCATCTCAAGG + Intergenic
1093990229 12:25582034-25582056 CAGGCTTTTGCCCCTTCACATGG - Intronic
1095136908 12:38615782-38615804 CAGGATAATCTCCCATCTCAAGG + Intergenic
1095971856 12:47907263-47907285 CAGGCTTTTCCAACATCTCCAGG + Intronic
1096500444 12:52061276-52061298 CTGGCTATTCCCACCTCACAGGG + Intergenic
1096775300 12:53960040-53960062 CAGGCCCCTCCCCCAGCTCATGG - Intergenic
1097987236 12:65796853-65796875 CATGCTATTCCCCTGCCTCAGGG - Intergenic
1098574763 12:72028617-72028639 CTGGCTGCTCCCCCATCTCCAGG + Intronic
1100163388 12:91888250-91888272 CAGGCTATTCCACCAACACTGGG + Intergenic
1100217076 12:92462264-92462286 CAGAATCTTCCCCTATCTCATGG + Intergenic
1102438724 12:112945566-112945588 GAGCCTGTTCCCCCATCTCCAGG - Intronic
1103674292 12:122643545-122643567 CAGGCTCATCCCCCATCTGCTGG - Intergenic
1103951371 12:124553263-124553285 TAGGATAATCTCCCATCTCAAGG + Intronic
1104071730 12:125351746-125351768 CAGGCTGTGCCCTCTTCTCAGGG - Intronic
1104345411 12:127992027-127992049 CAGGCTAAGCCCCAATTTCAGGG + Intergenic
1105315459 13:19256510-19256532 GATAGTATTCCCCCATCTCATGG + Intergenic
1106473328 13:30077105-30077127 CAGATTAATGCCCCATCTCAAGG + Intergenic
1107758119 13:43647792-43647814 CAGGATAATCTCCCATCTCCAGG - Intronic
1108573632 13:51772704-51772726 CACACTATTGCCCCATCCCAGGG + Intronic
1113675062 13:112201639-112201661 CAAACAAATCCCCCATCTCAGGG + Intergenic
1114662579 14:24357169-24357191 CAAGATAATCCCCCATCTCAAGG + Intergenic
1119424267 14:74525423-74525445 CAGTCTAATCCTCCATGTCAGGG + Intronic
1120622103 14:86776476-86776498 CAGACTAATACACCATCTCATGG + Intergenic
1124417732 15:29487629-29487651 CAGATTCTTCCCCCACCTCAGGG - Intronic
1126466968 15:48969629-48969651 CAGATAATTCCCCCATCTCAAGG - Intergenic
1127057819 15:55150519-55150541 CAGGCAAATCTCCCATCTCAAGG - Intergenic
1127852325 15:62924650-62924672 CAGGCTGTTTCCCGTTCTCAGGG + Intergenic
1129518502 15:76171203-76171225 CAGGGTGTACCCCCATCACACGG - Intronic
1131223904 15:90608075-90608097 CCTCCTCTTCCCCCATCTCAAGG - Intronic
1133602818 16:7356484-7356506 CAGGCTCCTCCTCCATCACAAGG - Intronic
1135496232 16:22953812-22953834 AAGGCGATTCCCCCTTCCCAGGG - Intergenic
1140023275 16:71260111-71260133 CAGGATAATCACCCATCTCAAGG - Intergenic
1140831988 16:78760386-78760408 CAGGATAGTTCCCCATATCAAGG + Intronic
1140916079 16:79494547-79494569 CAGGATAATCTCCCACCTCAAGG + Intergenic
1141066371 16:80917115-80917137 CAGGTTACTCTCCCATCTTAAGG + Intergenic
1141645315 16:85364345-85364367 CAGGCCCATCTCCCATCTCAAGG + Intergenic
1143025171 17:3937345-3937367 CAGGCGTTTTCCCCATCTCAGGG + Intronic
1143108907 17:4542785-4542807 CAGGCTCTGCTCCCATCCCAGGG - Intronic
1148156563 17:45428114-45428136 AAGGCCATTCCCCCACCTCCAGG + Intronic
1149153720 17:53600855-53600877 CAGGCAATCCTCCCACCTCAGGG + Intergenic
1150388248 17:64776763-64776785 AAGGCCATTCCCCCACCTCCAGG + Intergenic
1150791207 17:68201192-68201214 AAGGCCATTCCCCCACCTCCAGG - Intergenic
1151244858 17:72786608-72786630 CAGGCTATTCCTCAATGACAGGG + Intronic
1151875126 17:76863623-76863645 CAGGCTTTTCTCCCAGCTCCTGG - Intergenic
1152217025 17:79039310-79039332 CAGGCTAGCCCCCCACCACAGGG + Intronic
1152350305 17:79780482-79780504 CAAGCCATTCCCCCACCCCAAGG - Intronic
1152395413 17:80030065-80030087 CAGGATCATCCCCCATTTCAAGG + Intronic
1154151644 18:11910791-11910813 CAGGATCATCTCCCATCTCAAGG - Intergenic
1154427813 18:14285298-14285320 CAGGCTACTCCCCCTTCCTACGG - Intergenic
1155122180 18:22832552-22832574 CAGGATAATCTCCCACCTCAAGG - Intronic
1163033434 19:14558835-14558857 CAGGCTCTGGCCCCATCTCCAGG - Intronic
1164802606 19:31090221-31090243 CAGGCTAGTTCCCCTTCCCATGG + Intergenic
1168189352 19:54726603-54726625 CAGGCTGTCTCCCCATCGCAAGG - Intronic
1168193630 19:54757420-54757442 CAGGCTGTCTCCCCATCTCAAGG - Intronic
1168195692 19:54772159-54772181 CAGGCTGTCTCCCCATCTCAAGG - Intronic
1168197589 19:54787010-54787032 CAGGCTGTCTCCCCATCTCAAGG - Intronic
1168199636 19:54805339-54805361 CAGGCCATCTCCCCATCTCAAGG - Intronic
1168201518 19:54818866-54818888 CAGGCTGTCTCCCCATCTCAAGG - Intronic
1168204068 19:54836389-54836411 CAGGCTGTCTCCCCATCTCAAGG - Intronic
1168206257 19:54852549-54852571 CAGGCTGTCTCCCCATCTCAAGG - Intronic
924965399 2:72184-72206 CAGGGTGATCTCCCATCTCAAGG - Intergenic
926212828 2:10883763-10883785 CACTCTGTTCCCCCATCTCCTGG - Intergenic
931529516 2:63198508-63198530 CAGGCTCTTCCTCCAACACAGGG - Intronic
935132224 2:100269176-100269198 CAGGATAATCTCCCATCTCCCGG + Intergenic
935342226 2:102068454-102068476 CAGACTAATACACCATCTCAGGG + Intronic
935755503 2:106273415-106273437 CAGGCTGTGCCCCCAGCTCCTGG + Intergenic
937855437 2:126669320-126669342 CAGGCCATGCCCCCTCCTCAGGG + Intronic
937982869 2:127625264-127625286 CGGGCTCTTGCCCCATCACAGGG - Intronic
938089520 2:128422176-128422198 CAGCCCCTTGCCCCATCTCATGG + Intergenic
943374516 2:187058653-187058675 CAGCATATTCCTCCATTTCAAGG - Intergenic
945027664 2:205634492-205634514 CAAAGTAATCCCCCATCTCAAGG - Intergenic
946038564 2:216764514-216764536 CAGGATAATCTTCCATCTCAAGG + Intergenic
1170097194 20:12659107-12659129 GAGTGTATTCCTCCATCTCATGG + Intergenic
1170195121 20:13681507-13681529 CTGGTTCTTGCCCCATCTCAAGG - Intergenic
1173216453 20:41089321-41089343 CAGCCTATTCCCCCAGTTCTTGG + Intronic
1174705331 20:52649458-52649480 CAGGATAATCTCCCACCTCAAGG - Intergenic
1175228586 20:57459746-57459768 CCCTCTATTCACCCATCTCAGGG - Intergenic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1175495285 20:59410325-59410347 CACTCTATTACCCCATTTCATGG + Intergenic
1175764199 20:61581682-61581704 CAGGGTAATCTCCCATCCCAAGG + Intronic
1175988417 20:62775857-62775879 CAGAATAATCTCCCATCTCAAGG + Intergenic
1176958084 21:15129116-15129138 CATGCTATTACCTCATCACATGG + Intergenic
1179708957 21:43200920-43200942 CAGGTGATTCTCCCACCTCAGGG + Intergenic
1180793752 22:18591904-18591926 GAGGCTGTTGCCCCAGCTCAGGG - Intergenic
1181145304 22:20841725-20841747 CAGGATATCCCTCCATTTCAAGG - Intronic
1181227988 22:21403416-21403438 GAGGCTGTTGCCCCAGCTCAGGG + Intergenic
1181250665 22:21531423-21531445 GAGGCTGTTGCCCCAGCTCAGGG - Intergenic
1181545612 22:23600424-23600446 CAGGCCCTACCCCCTTCTCAGGG - Intergenic
1181814698 22:25429475-25429497 CAGGCCCTGCCCCCTTCTCAGGG + Intergenic
1184201149 22:42970854-42970876 CAGGCCAGCCTCCCATCTCATGG - Intronic
1184370454 22:44078561-44078583 CAGGCTAATCTCCCACCCCAAGG + Intronic
1184370760 22:44080558-44080580 CAGGCTAATCTCCCACCCCAAGG + Intronic
949479098 3:4476565-4476587 CAGGTTATCTCCCCATCTCAAGG - Intergenic
950852584 3:16076916-16076938 CAGGCTATTATCCCCTTTCATGG - Intergenic
953841994 3:46396623-46396645 CAGGCAATGCCCCCTTCCCAGGG + Intergenic
956556967 3:70534975-70534997 CAGGTTATCCACCCATCTCTCGG + Intergenic
956960347 3:74392045-74392067 CATATTTTTCCCCCATCTCAGGG - Intronic
957461144 3:80522006-80522028 CAGGATTTTCCCCCTTCTTAAGG - Intergenic
958672321 3:97220582-97220604 GAGGCTCTTCCCCCTTCTCTAGG - Intronic
959630769 3:108504992-108505014 CTGGCCATTCCCCCATCTCTTGG + Intronic
960437927 3:117650148-117650170 CAGGCTGCTCCCACAGCTCAGGG - Intergenic
965698762 3:171438191-171438213 GAGGCCATTTCACCATCTCAGGG + Intronic
967301805 3:188021599-188021621 CAGGCTTTTCTTCCAGCTCATGG - Intergenic
968616674 4:1580624-1580646 CAGGCCCTGCCCCCAACTCAGGG + Intergenic
969431560 4:7157924-7157946 CAAGCAATGCTCCCATCTCAGGG + Intergenic
971259463 4:25043226-25043248 CAGGCTCTTCCCTCTACTCAAGG - Intergenic
975053168 4:69892332-69892354 CAGGCTATTCCTCCAACACTGGG - Intergenic
976070763 4:81237065-81237087 CTGTCTATTCCTCCATCCCATGG + Intergenic
978204494 4:106064055-106064077 GAGGCTTTTCCCCCCTCTCCCGG - Intronic
978651018 4:111005272-111005294 CAGGCAATTCTACCATCTGATGG - Intergenic
982643779 4:157996531-157996553 CAGGCCAGTCCCACATGTCAAGG + Intergenic
982981673 4:162145432-162145454 CAAGCAATTCCCAAATCTCAGGG + Intronic
983029738 4:162784939-162784961 CAAGCTATCCCCCTATCTGAGGG - Intergenic
985905837 5:2835448-2835470 CAGGCAAATCACCCAACTCAAGG + Intergenic
986979302 5:13428532-13428554 CAGGATATTCCCGCATTTCAAGG + Intergenic
987785503 5:22493713-22493735 CAGCCTTTCCTCCCATCTCACGG - Intronic
989535168 5:42555157-42555179 CAGGATAATGCCCCATGTCATGG + Intronic
992076682 5:73198522-73198544 CGGGCTACTCCCTCATCTCAAGG + Intergenic
995780482 5:115770080-115770102 CAGTCCATGCTCCCATCTCATGG + Intergenic
999412514 5:151364802-151364824 CAGGCTTTTCTTCCATCTCTTGG + Intergenic
999480970 5:151947993-151948015 CAAGCTGTTTGCCCATCTCAGGG - Intergenic
999791544 5:154944401-154944423 GAGGATATGCCCCCATCTAAAGG - Intronic
1000800439 5:165719871-165719893 AAGGTTATGCCCCCTTCTCAGGG - Intergenic
1002434885 5:179225155-179225177 CAGGCTCCTCCTCCCTCTCATGG + Intronic
1002867668 6:1137192-1137214 CAGTTCATGCCCCCATCTCAAGG - Intergenic
1004118151 6:12791338-12791360 CAGTATATTCCTCCATCCCAGGG - Intronic
1005299000 6:24452673-24452695 TAAGTTATTCTCCCATCTCAAGG - Intronic
1006614802 6:35318790-35318812 CAGTCTAATCCCCAATCACACGG - Intronic
1007465247 6:42047282-42047304 CAGGCTATTCCCACAGCTGTTGG - Intronic
1008140572 6:47827381-47827403 TAGGATATTCCCCCAACTCCTGG + Intronic
1008938302 6:57016757-57016779 CAGGATAATCTCCCATCTCAAGG + Intronic
1013713263 6:112926715-112926737 CAGGCTTCTCACACATCTCATGG + Intergenic
1018059720 6:160080796-160080818 CATGCATTTCCCTCATCTCACGG - Intronic
1020783139 7:12540177-12540199 GAGGCTTTTCCTCCATTTCAAGG + Intergenic
1021055614 7:16042826-16042848 CGGGATATTCTCCCACCTCAGGG - Intergenic
1022136381 7:27453288-27453310 CATGCAAGTCCCTCATCTCAAGG + Intergenic
1024790893 7:52963827-52963849 CAGGCAATTCCCCATTCACAAGG - Intergenic
1025901960 7:65751622-65751644 CGGGCTTTTCCCCGATCTTAGGG - Intergenic
1026521354 7:71120895-71120917 TAGGATAATCTCCCATCTCATGG - Intergenic
1028392414 7:90332134-90332156 CATGCTATTGCCCCCTCTGAGGG + Intergenic
1028478531 7:91278171-91278193 CAGGATAATTCCCCATCTCAAGG + Intergenic
1030914473 7:115295603-115295625 CAGGCCACTCCCCCAGCACATGG - Intergenic
1033608630 7:142944986-142945008 CAGGCTATTTCCCCATGGAAAGG - Intronic
1038010379 8:23471215-23471237 CAAGCTAATCTCCCATTTCAAGG + Intergenic
1038501275 8:28046267-28046289 CAAGCAGTTCCCCCATCTCTGGG + Intronic
1042097446 8:65232810-65232832 GAGCCTATTCTCCCAGCTCAGGG - Intergenic
1042708729 8:71691183-71691205 CAGGAGAATCTCCCATCTCAAGG + Intergenic
1042930339 8:74007142-74007164 CAGGCTACTCCCGCCTGTCATGG - Intronic
1043158074 8:76811098-76811120 CAAGCTAAACCCTCATCTCACGG + Intronic
1043802275 8:84624594-84624616 CAGGACATCTCCCCATCTCAAGG + Intronic
1044270914 8:90242325-90242347 CAAGTGATTCTCCCATCTCAGGG - Intergenic
1048284372 8:133130394-133130416 CAGGATAAGCTCCCATCTCAAGG - Intronic
1048496395 8:134939557-134939579 CACGCTTTTCCCCAGTCTCAGGG - Intergenic
1048622262 8:136147087-136147109 CAGGATAATCTCCCACCTCAAGG - Intergenic
1050133867 9:2441438-2441460 CAGGCTATTACAGCACCTCATGG - Intergenic
1050702546 9:8357340-8357362 CAAGCTATTCCTGCATCTCTTGG - Intronic
1052848517 9:33359623-33359645 CTGACTAATCCTCCATCTCATGG + Intronic
1056827969 9:89890096-89890118 CAGGCTCTTCCCCCAGCACTGGG + Intergenic
1056961359 9:91126768-91126790 ATGGCTATTTCACCATCTCATGG - Intergenic
1058706084 9:107638836-107638858 CAAGCATTTTCCCCATCTCAGGG - Intergenic
1060209281 9:121700040-121700062 CAGGCTGTGCCCCCAGCTCAGGG - Intronic
1061023937 9:128035219-128035241 CAGGCTCTTCCTCCACCCCAGGG - Intergenic
1062144888 9:134983482-134983504 CAGGATAAGCCCCCATCCCAGGG - Intergenic
1062307201 9:135914706-135914728 CAGGATAACCCCCCATCTGAAGG - Intergenic
1062378169 9:136274317-136274339 CAGGCTGGTCCCCCAGCTCTAGG + Intergenic
1185664103 X:1750733-1750755 CAGGCTGTTCTCCCGTGTCAGGG + Intergenic
1186289986 X:8086623-8086645 GAGGCTCTTCCCCCTTCTCTTGG - Intergenic
1189595415 X:42559826-42559848 CAGCCAATTGCCCCATCTCAAGG + Intergenic
1191042353 X:56097428-56097450 CAAGCTATCCACCCACCTCAGGG + Intergenic
1192730174 X:73795212-73795234 CAGGAGAATCTCCCATCTCAAGG - Intergenic
1197450085 X:126601867-126601889 CTGTCTATTCTCCCATCTCAGGG + Intergenic
1198285937 X:135192002-135192024 CATGCAATTCCCCCATCTACAGG - Intergenic