ID: 1076535842

View in Genome Browser
Species Human (GRCh38)
Location 10:131176417-131176439
Sequence CTCTGTGTGTACATGTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 713
Summary {0: 2, 1: 2, 2: 10, 3: 64, 4: 635}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076535842 Original CRISPR CTCTGTGTGTACATGTGTCT TGG (reversed) Intronic
900102793 1:969550-969572 GTATGTGTATACATGTGTATGGG + Intronic
900312739 1:2042071-2042093 TGCTGTGTGTGCATGTGTGTGGG + Intergenic
900489178 1:2938007-2938029 CTGTGTGTGCACATGTGTAGGGG - Intergenic
900489201 1:2938385-2938407 GTCTGTGTGTGCATGTGTGTGGG - Intergenic
900489205 1:2938469-2938491 CTCTGTGTGTGCATGTGTGGGGG - Intergenic
900596452 1:3482287-3482309 CTCTGTGTGTGCGTGTGTGTTGG + Intergenic
900908608 1:5578070-5578092 CTCTGTGTGTGGGTGTGTGTGGG + Intergenic
900949006 1:5847119-5847141 CTCTGTGTGTAAATGAGGCCTGG - Intergenic
900971941 1:5996615-5996637 CTCTGTGGGTACCTGTGTGCTGG - Intronic
901474163 1:9477732-9477754 ATGTGTGTGTATATGTGTGTGGG - Intergenic
901804612 1:11730303-11730325 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
901804619 1:11730365-11730387 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
902701802 1:18177427-18177449 GTGTGTGTGTACATGGTTCTTGG + Intronic
903061032 1:20668987-20669009 CTCTTGGTGTCCTTGTGTCTGGG - Intronic
903277711 1:22232430-22232452 CACCATGTGTACATGTGTCATGG - Intergenic
903325151 1:22564957-22564979 CTGTGTGTGTGCTTGTGTGTAGG - Intronic
903549527 1:24148260-24148282 CTCTGTCTGTAAAGGAGTCTTGG + Intergenic
903634744 1:24804368-24804390 GTATGTGTGTGCATGTGTGTGGG + Intronic
903641744 1:24864772-24864794 CCCTGAGTGTACCTCTGTCTAGG + Intergenic
903659984 1:24971008-24971030 TTGTGTGTGTGCATGTGTGTGGG + Intergenic
903752957 1:25640749-25640771 CTCTGAGTGTACATTAGTGTGGG - Intronic
904104743 1:28069686-28069708 AACTGTGTGTATATGTGTTTGGG - Intronic
904272687 1:29360964-29360986 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
904607562 1:31706098-31706120 ATCTGTGTGTAACTGTTTCTAGG - Intergenic
904825211 1:33269833-33269855 CTCTTTCTGTCCATTTGTCTAGG + Intronic
905267166 1:36762608-36762630 GTCTGTGTGTATTTGTGTTTGGG - Intergenic
905353500 1:37364162-37364184 CTGTGTGTGTGTGTGTGTCTAGG - Intergenic
905394181 1:37656771-37656793 CTCTGTGTGTCCATGTGTGTTGG + Intergenic
906145877 1:43560441-43560463 CTGTGTGTGTAGGTGTGCCTCGG + Intronic
906250467 1:44307170-44307192 CTCTGTGTGCTCATGTGATTTGG + Intronic
906291311 1:44621224-44621246 GTCTTTATGGACATGTGTCTGGG + Intronic
906457961 1:46013847-46013869 GTGTGTGTGTATATGTGTGTTGG + Intronic
906475634 1:46167505-46167527 CTTTGTGTGTATGTGTGTCTTGG + Intronic
906568924 1:46819916-46819938 ACATGTGTGTACATGTGTGTGGG + Intergenic
906782595 1:48585809-48585831 CTCTGTTTGTATGTGTGTTTGGG - Intronic
908514112 1:64874890-64874912 CTCTGTGAGTTCCTGTCTCTGGG + Intronic
909148344 1:71967649-71967671 ATTTGTGTGTACGTGTTTCTTGG - Intronic
909523011 1:76591201-76591223 CTCTGTGTGTATGTGTGTGTAGG + Intronic
909975499 1:82041999-82042021 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
912017238 1:105056021-105056043 ATCTGTGTGTCTATGTGTGTGGG - Intergenic
912244766 1:107949723-107949745 CTGTGTGTGTACATGTACTTTGG - Intronic
912383955 1:109262167-109262189 GCATGTGTGTACGTGTGTCTGGG + Intronic
912837286 1:113007755-113007777 GTCTGTGTGGCCATGAGTCTAGG - Intergenic
913189876 1:116404505-116404527 CTCTTTGTGTACTTCAGTCTTGG + Exonic
913690127 1:121271736-121271758 ATGTGTGTGTGCATGTGTGTTGG + Intronic
913936940 1:125064388-125064410 GTGTGTGTCTGCATGTGTCTGGG - Intergenic
914147413 1:145008227-145008249 ATGTGTGTGTGCATGTGTGTTGG - Intronic
914750222 1:150529932-150529954 CTGTGTGTGTGCATTTTTCTGGG + Intergenic
914893202 1:151646831-151646853 CTGTGTGTGTGCGTGTGTCAAGG + Intronic
915293490 1:154902556-154902578 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
916418506 1:164614507-164614529 CTCTATGTTGACATGTGACTTGG + Intronic
917000062 1:170347860-170347882 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
917659941 1:177168010-177168032 GTCTGTGTGCACATGTGTGGTGG - Intergenic
918892229 1:190290151-190290173 CTTTGAGTGTTCATGTGACTAGG + Intronic
919249055 1:195029882-195029904 GTTTGTGTGTACATATGTCATGG + Intergenic
919444010 1:197678190-197678212 CTCTGTAATTACATGTGTCATGG - Intronic
920073382 1:203319771-203319793 CTCTGTGTGTGTGTGTGTGTGGG + Intergenic
920477449 1:206290217-206290239 ATGTGTGTGTGCATGTGTGTTGG + Intronic
920634078 1:207681842-207681864 CTATTTGTGTGCATGTGTGTTGG + Intronic
921445377 1:215240415-215240437 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
921576088 1:216836595-216836617 CTCTGTGTGTACAAGGAGCTTGG + Intronic
921715602 1:218414214-218414236 GTGTGTGTGCACATGTGTTTAGG - Intronic
921853488 1:219955204-219955226 CTTTGTGTGTGCATGTGTTTCGG - Intronic
922093815 1:222423817-222423839 CTCTGTGTGCACATGTGTTGAGG - Intergenic
922776665 1:228217296-228217318 CGCTGTGTGTGCATGCGTCCAGG + Intronic
923723878 1:236489852-236489874 TCCTGTGTGTAGATGTGTCGGGG - Intergenic
1062800784 10:378870-378892 GTCTGTGTTCACGTGTGTCTAGG - Intronic
1062961902 10:1578658-1578680 CTCTGTGTGTGTGTGTGTTTGGG - Intronic
1064308848 10:14193473-14193495 CTCTGTGTGTGTGTGTGTGTGGG - Intronic
1064721899 10:18237364-18237386 CTCTCTGTGTATCTGTGTCTTGG - Intronic
1065921456 10:30396939-30396961 GTTTGTGTGTACATGTGGATGGG - Intergenic
1066206098 10:33190796-33190818 GTGTGTGTGTGCATGTGTGTTGG + Intronic
1067442556 10:46317706-46317728 GTGTGTGTGTGCATGTGTTTTGG - Intronic
1067449985 10:46376201-46376223 CCTTGTGTGTAAATGTGTATGGG + Intronic
1067587259 10:47483562-47483584 CCTTGTGTGTAAATGTGTATGGG - Intronic
1067634317 10:47991329-47991351 CCTTGTGTGTAAATGTGTATGGG - Intergenic
1068301444 10:55146910-55146932 CTCTGTGTGTATATGTGGCGGGG + Intronic
1068407593 10:56611000-56611022 TTGTGTGTGTGCATGTGTGTGGG - Intergenic
1068866636 10:61902075-61902097 GTCTGTGTGTAAATGTGTCTGGG + Intronic
1070295429 10:75157057-75157079 GTATGTGTGTATATGTGTGTAGG + Intronic
1070589715 10:77793271-77793293 CTCTGTGTGTGTGTGTGTGTGGG - Intronic
1070701185 10:78602724-78602746 CTCTGGGTGCTCAGGTGTCTGGG - Intergenic
1070823568 10:79377312-79377334 ATGTGTGTGCACATGTGTGTGGG + Intergenic
1070981980 10:80656577-80656599 GTCTGTGTGTGTCTGTGTCTGGG + Intergenic
1071083561 10:81841414-81841436 CTCTGTGTTTACATGTTGATTGG + Intergenic
1071198597 10:83191186-83191208 CTCTGTGTGTACATGCCCCAAGG - Intergenic
1071717412 10:88111268-88111290 GTGTGTGTGTACCTGTGTCAGGG + Intergenic
1072320449 10:94244593-94244615 CTCTCTCTGTGCATGTGTGTAGG - Intronic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1073061462 10:100736145-100736167 CTCTGTGTGTACCTGTGTGTAGG + Intronic
1073250471 10:102117881-102117903 TTCTGCGTGTGCATGTGTGTGGG + Intronic
1073841340 10:107502502-107502524 TTGTGTGTTTAAATGTGTCTGGG + Intergenic
1073964465 10:108972773-108972795 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
1074716534 10:116225088-116225110 CTGAGTGGGTACATGTGGCTGGG - Intronic
1074844251 10:117383127-117383149 GTGTGTGTGTACATGTGTGTTGG + Intergenic
1074868769 10:117561135-117561157 CTCTGTGTGTGTGTGTGTTTAGG + Intergenic
1075082618 10:119393961-119393983 GTCTGTGTGTAGGTGTGTGTGGG + Intronic
1075082685 10:119394394-119394416 CTGTGTGTGGGCATGTGTGTGGG + Intronic
1075483019 10:122798451-122798473 GTGTGTGTGTATATGTGTGTGGG - Intergenic
1076003666 10:126931391-126931413 CTCTGTGTGGAAGTCTGTCTTGG + Intronic
1076535835 10:131176285-131176307 CTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535842 10:131176417-131176439 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535843 10:131176455-131176477 GTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535844 10:131176491-131176513 CTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535849 10:131176583-131176605 CTGTGTGTGTGCATGTGTTTTGG - Intronic
1076535851 10:131176641-131176663 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535852 10:131176679-131176701 GTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535859 10:131176767-131176789 CTCTGTGTGTCCATGTGTCTTGG - Intronic
1076535862 10:131176877-131176899 GTCTGTGTGTGCATGTGTTTTGG - Intronic
1076535864 10:131176945-131176967 CTCTGTGTGTACACGTGTCTTGG - Intronic
1076535866 10:131176983-131177005 GTCTGTGTGTACACCTGTCTTGG - Intronic
1076782750 10:132733262-132733284 CTCTGGGTGAACATGAATCTGGG + Intronic
1076919393 10:133443662-133443684 ACCTGTGTATACCTGTGTCTCGG - Intergenic
1076919412 10:133443844-133443866 ACCTGTGTATACCTGTGTCTCGG - Intergenic
1076947507 10:133661328-133661350 CTCTTTGTGCACTAGTGTCTTGG + Intergenic
1077260352 11:1615421-1615443 TTCCGTGTGCACATGTCTCTGGG - Intergenic
1077314989 11:1915562-1915584 TTCTGTGTGTGCATGTGTTGGGG + Intergenic
1077320696 11:1939709-1939731 TTCTGTGTGTGCATGTGTTGGGG - Intergenic
1077425084 11:2471872-2471894 GTGTGTGTGCACATGTGTATAGG + Intronic
1077425091 11:2471994-2472016 GTGTGTGTGCACATGTGTATAGG + Intronic
1077425094 11:2472046-2472068 GTATGTGTGCACATGTGTGTAGG + Intronic
1077425102 11:2472193-2472215 CTATGTGTGCACATGTGTGTAGG + Intronic
1078065930 11:8079690-8079712 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1079145773 11:17850392-17850414 CTGTATGTGTACGTGTGTGTTGG - Intronic
1080065274 11:28003419-28003441 TTGGGTGTGTACATGTGTTTAGG + Intergenic
1080655777 11:34256964-34256986 CTCTGTGTGTAGATGAGCCCTGG - Intronic
1081539739 11:44023986-44024008 CTCTGTGTGTCAATTTGACTGGG + Intergenic
1081621833 11:44623391-44623413 CTGTGTGTGCACGTGTGTCCTGG - Intergenic
1081854212 11:46293829-46293851 GTCTGTGTGATCCTGTGTCTGGG + Intronic
1082662544 11:55930175-55930197 TTGTGTGTGTGCATGTGTGTAGG + Intergenic
1082683077 11:56202960-56202982 CTGTGTGTATATATGTGTTTAGG + Intergenic
1082987296 11:59179901-59179923 GTCTGTGTGTGTATGTGTGTAGG - Intronic
1083280456 11:61623809-61623831 CTGTGTGTGTACATTCTTCTTGG - Intergenic
1083766538 11:64844165-64844187 GTATGTGTGTGCATGTGTCGGGG + Intronic
1084439245 11:69161939-69161961 CTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1084523481 11:69680907-69680929 GTCTGTGTGTGCATGTGTGTGGG - Intergenic
1084618300 11:70251288-70251310 ATCTGTGTGTACTCCTGTCTCGG - Intergenic
1084676199 11:70636794-70636816 GTGTGTGTGAACATGTGTGTGGG + Intronic
1085024229 11:73227415-73227437 CTCTGTGTATCCGTGTGTCTTGG + Intronic
1085443561 11:76583541-76583563 ATATGTGTGTGCATGTGTGTTGG - Intergenic
1086050463 11:82583033-82583055 CACTCTGTCTACATGTTTCTAGG + Intergenic
1086469004 11:87086567-87086589 CTCTCAGTGTGCCTGTGTCTGGG + Intronic
1086944934 11:92835731-92835753 CTCTGTGTGTCTGTGTGTGTAGG - Intronic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1087437231 11:98136613-98136635 GTCTTTCTGCACATGTGTCTTGG + Intergenic
1087978499 11:104581117-104581139 AACTGTGTGTTCATGTTTCTTGG + Intergenic
1088126430 11:106430506-106430528 CTCTGTGTGTATATGTAACTTGG - Intergenic
1088783008 11:113154640-113154662 CTCTATGTGTTCATGTGTGGCGG - Intronic
1088867793 11:113865224-113865246 CTTTGTGTGTGCGTGTGGCTGGG + Intronic
1089681284 11:120120332-120120354 GTGTGTGTGTACATGTGTGGGGG - Intronic
1089976929 11:122740708-122740730 CCATCTGTGTACATGTGTGTGGG + Intronic
1090406471 11:126478699-126478721 ATGTGTGTATACATGTGTATGGG + Intronic
1090833527 11:130437208-130437230 GTGTGTGTGCACATGTGTGTAGG - Intergenic
1091015160 11:132044026-132044048 GTATGTGTGTATATGTGTATGGG + Intronic
1091683858 12:2547543-2547565 CTGTGTGTGTAAATGCGTGTGGG + Intronic
1092972656 12:13712471-13712493 CTTTGTGTATAGATGTGTATTGG + Intronic
1094485175 12:30920161-30920183 ATATGTGTGTACATGTGAATAGG + Intergenic
1094775392 12:33720823-33720845 CTCTCTGTCTCCATGTGTATAGG - Intergenic
1096108048 12:49010043-49010065 TTCTGTGTGTACATGAGGTTGGG + Intronic
1096227821 12:49877826-49877848 CTATGTGCGTATATGTGTGTAGG + Intronic
1097371875 12:58793312-58793334 TTATGTGTGTGCATGTGTCAGGG + Intronic
1097547117 12:61017684-61017706 CTCTGTGTGTATTTATTTCTTGG + Intergenic
1098396940 12:70029036-70029058 CTCTATGTGCATATGTGTTTGGG + Intergenic
1098527868 12:71507429-71507451 CTGTGTCTGTGCATGTGTCTGGG + Intronic
1098611581 12:72465285-72465307 CTGTGTGTATACATGTGTTAAGG - Intronic
1099530958 12:83780846-83780868 ATCTGTGTGTACATATGTTTAGG - Intergenic
1099781530 12:87201929-87201951 CTTAGTGTGTACATGTGTATTGG + Intergenic
1100707841 12:97220929-97220951 CTCAGTGTGTCAATATGTCTGGG - Intergenic
1101545109 12:105705090-105705112 CTCTGTGTGTGTGTGTGTGTGGG - Intergenic
1102029672 12:109732729-109732751 GTGTGTGTGTACACGTGTGTGGG - Intronic
1102237879 12:111305988-111306010 CTGTGTGTGTCCATGTTCCTGGG + Intronic
1102314090 12:111872380-111872402 CACTTTTTGTACATGTGTATTGG + Intronic
1102866078 12:116375421-116375443 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1103678502 12:122675598-122675620 CTCTGTGGGCTCCTGTGTCTGGG + Intergenic
1104698299 12:130881196-130881218 CTCTGTGTGTCTGTGTCTCTGGG + Intergenic
1104712144 12:130994581-130994603 CTCTGTGTTTCCGGGTGTCTAGG + Intronic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1104938005 12:132376857-132376879 CTCTCTGTCTACCTGTCTCTCGG - Intergenic
1106373367 13:29159306-29159328 CTCTATGTGCATGTGTGTCTAGG + Intronic
1106486072 13:30173883-30173905 GTGTGTGTGCACATGTGTGTGGG - Intergenic
1107357649 13:39584862-39584884 CTGTGTGTGCACAGTTGTCTTGG - Intronic
1107394681 13:40003201-40003223 CTCTGTGTCTACGTGTGTGGGGG - Intergenic
1108004361 13:45932334-45932356 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1108413826 13:50177454-50177476 TTCTGTATGTATATGTGTGTGGG + Intronic
1108425854 13:50299430-50299452 ATGTGTGTGTACATGTATATGGG - Intronic
1108853897 13:54769785-54769807 ATGTGTGTATACATGTGTATGGG - Intergenic
1109254894 13:60067922-60067944 CTCTATGTGTATATGTGTGTGGG - Intronic
1109528607 13:63608794-63608816 CTGTGTATGTATATGTGTTTTGG + Intergenic
1110057751 13:70998057-70998079 GTCTGTGTGTGCATGTGTGATGG + Intergenic
1110091276 13:71451172-71451194 AACTGTGTGTACATGAGTTTAGG - Intronic
1110457526 13:75706592-75706614 CTGTGTGTGTGCATGGGTGTAGG - Intronic
1110500793 13:76225340-76225362 GTGTGTGTGTGCATGTGTTTAGG - Intergenic
1111384092 13:87500842-87500864 CTCTGTGTCTGAATGTCTCTAGG - Intergenic
1111933796 13:94538447-94538469 CTATGTGTATACATATGGCTTGG - Intergenic
1112668456 13:101605754-101605776 ATATGTGTGTACACGTGTGTAGG + Intronic
1112814514 13:103256185-103256207 GATTGTGTGTACATGTGTGTGGG - Intergenic
1113089157 13:106598804-106598826 CTCTGTGTACATATGTGTCATGG - Intergenic
1113811087 13:113143118-113143140 CTCTGTGGCCACACGTGTCTGGG - Intronic
1113870561 13:113557182-113557204 GTGTGTGTGCACATGTGTGTAGG + Intergenic
1114788302 14:25626268-25626290 CTGTGTGTGTATGTGTGTGTTGG + Intergenic
1115909619 14:38241033-38241055 ATATGTGTATACATGTGTGTAGG + Intergenic
1117541801 14:56754614-56754636 CTCTCTGTTTTCATGTTTCTAGG - Intergenic
1119038477 14:71250779-71250801 CTCTCTATGGACATGTGACTTGG - Intergenic
1119488357 14:75007836-75007858 GTTTGTGTGTGCATGTGTTTTGG + Intronic
1119635874 14:76273067-76273089 CTCTGTGTGTGCATGTGTGTGGG - Intergenic
1119696117 14:76714615-76714637 GCATGTGTGTACATGTGTTTGGG - Intergenic
1120522011 14:85534609-85534631 CTGTGTGTGTGCGTGTGTTTGGG + Intronic
1120747774 14:88167314-88167336 CTGTGTGTGTATGTGTGTGTGGG - Intergenic
1121301620 14:92876145-92876167 GTATGTGTGTGCATGTGTGTGGG - Intergenic
1121372889 14:93376485-93376507 CTATATGTGTATATGTGTATAGG - Intronic
1121569704 14:94937820-94937842 CTGTGTGTGTATATCTGTGTGGG + Intergenic
1122938059 14:104968952-104968974 GGCTGTGTGTGCCTGTGTCTGGG - Intronic
1123080238 14:105689289-105689311 ATGTGTGTGTATATGTGTATGGG - Intergenic
1123125975 14:105946265-105946287 ATGTGTGTGTGCGTGTGTCTTGG - Intergenic
1123186103 14:106518451-106518473 CTCTGTGTGCACCTGCCTCTTGG + Intergenic
1123475547 15:20590268-20590290 CTATGTGTGTATATGTGCATAGG - Intergenic
1123642464 15:22410095-22410117 CTATGTGTGTATATGTGCATAGG + Intergenic
1123929018 15:25149008-25149030 GTCTCTGTGTGCCTGTGTCTTGG - Intergenic
1124250876 15:28105924-28105946 GGGTGTGTGTGCATGTGTCTGGG + Intergenic
1124250890 15:28106055-28106077 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1124250916 15:28106230-28106252 GTGTGTGTGTGCATGTGTCGGGG + Intergenic
1124264954 15:28224148-28224170 CTCTGTGTGTGTGTGTGTGTGGG - Intronic
1124998402 15:34746382-34746404 TGCTGTGTGTACATGTGAGTTGG - Intergenic
1125770163 15:42159873-42159895 CTCTGTGGGAACATGTATCTAGG + Exonic
1126497904 15:49312781-49312803 CCTTGTGTTTACATATGTCTGGG + Intronic
1126937375 15:53726329-53726351 GACTGTGTGTACACGTGTGTTGG + Intronic
1127762060 15:62149169-62149191 CTGGGTGTGTATATGTGTTTTGG + Intergenic
1128301858 15:66570967-66570989 ACCTGTGTGTGCATGTGTGTGGG + Intergenic
1128684785 15:69675750-69675772 CTCTCTGTGTCCATATGTCTGGG + Intergenic
1129053019 15:72797706-72797728 CTCTGTGTGTATATATTTGTGGG + Intergenic
1130836082 15:87651452-87651474 CTCTGTATGTACACGTATGTGGG + Intergenic
1131251152 15:90830926-90830948 CTCTGTTTTTAGATGTGTCATGG - Intergenic
1132025773 15:98403398-98403420 CTCTGTGGGGCCACGTGTCTTGG - Intergenic
1132225795 15:100140448-100140470 CTGTGTGTGTGTGTGTGTCTTGG - Intronic
1132475432 16:134216-134238 GTGTGTGTGTACATGTGCATAGG - Intronic
1132482956 16:175713-175735 CTCTGTGTGTACTTGTGTGATGG + Intergenic
1132505458 16:306156-306178 GTGTGTGTGTACGTGTGTGTGGG - Intronic
1132688774 16:1173052-1173074 CTCTGTGTGGCCATGGGCCTGGG + Intronic
1132699740 16:1217298-1217320 GTCTGTGTGTGCACGTCTCTAGG - Intronic
1133876101 16:9736049-9736071 ATCTGTGTGTGTATGTGTGTTGG - Intergenic
1134006701 16:10822791-10822813 CTGTGTGTGTACCTCTGTCCAGG - Intergenic
1134059843 16:11192496-11192518 GTGTGTGTGTGCATGTCTCTGGG - Intergenic
1134147676 16:11779786-11779808 GTGTGTGTGTACACGTGTGTGGG + Intronic
1134782249 16:16908895-16908917 GTGTGTGTGTGCGTGTGTCTGGG + Intergenic
1135397155 16:22139940-22139962 ATGGGTGTGTACATGTGTGTAGG - Intronic
1135612141 16:23877604-23877626 CTCTTTCTGTGCATTTGTCTGGG + Intronic
1135856079 16:26011729-26011751 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1136134399 16:28246065-28246087 CTTTGTGTGTGTGTGTGTCTGGG - Intergenic
1136291486 16:29275071-29275093 GACTGTGTGTCCGTGTGTCTTGG + Intergenic
1136475685 16:30511719-30511741 CTCTGTGTGTGCATGAGTTTGGG - Intronic
1137540964 16:49361349-49361371 GCCTGGGTGAACATGTGTCTTGG + Intergenic
1140838940 16:78821075-78821097 TTCTGAGTGAACATGTTTCTAGG + Intronic
1141015207 16:80442532-80442554 ATCTGTGGTTAAATGTGTCTGGG - Intergenic
1141243302 16:82283295-82283317 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1141814431 16:86400104-86400126 TTCTGTGTGAACACGTGGCTTGG + Intergenic
1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG + Intergenic
1141928858 16:87187020-87187042 ATGTGTGTGTGCATGTGTGTGGG + Intronic
1141928887 16:87187331-87187353 TATTGTGTGTACATGTGTGTGGG + Intronic
1141928899 16:87187511-87187533 GTATGTGTGTACATGTGTGTGGG + Intronic
1141928978 16:87188164-87188186 GTGTATGTGTACATGTGTGTAGG + Intronic
1142289937 16:89189254-89189276 CTGTGTGTGGGCATGTGTGTGGG - Intronic
1142410622 16:89914450-89914472 CTGTGTGTGTGCCTGTGTGTGGG + Intronic
1143020572 17:3915345-3915367 CTCTGTGCCTATATGTGTCTGGG - Intronic
1143232661 17:5370231-5370253 GTGTGTGTGTACGTATGTCTTGG + Intronic
1143671699 17:8400727-8400749 CTATGTGTGTTTATGTGTGTTGG + Intergenic
1143825004 17:9598404-9598426 GTGTGTGTGTACATGGGGCTGGG + Intronic
1144212192 17:13025054-13025076 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
1144786303 17:17834007-17834029 CTGTGTGTTTATATGTGTTTGGG - Intronic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1146341971 17:32027469-32027491 CTGTGTGTGTGCTTGTGTGTGGG + Intronic
1146494721 17:33311448-33311470 GTGTGTGTGTAGATGTGTGTAGG + Intronic
1146655379 17:34631835-34631857 TCCTGTGTGTACATGCATCTAGG - Intronic
1146675966 17:34774142-34774164 GCCTGTGCTTACATGTGTCTAGG - Intergenic
1146913320 17:36661961-36661983 CTCTGCATGCACATGTGTGTGGG - Intergenic
1147533320 17:41300447-41300469 ATATGTGTGTGCATGTGTGTGGG + Intergenic
1147585503 17:41651907-41651929 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
1147585510 17:41651976-41651998 TTGTGTGTGTGCATGTGTGTTGG - Intergenic
1147585518 17:41652062-41652084 GTATGTGTGTGCATGTGTGTTGG - Intergenic
1147585521 17:41652101-41652123 GTATGTGTGTGCATGTGTGTTGG - Intergenic
1148682076 17:49479944-49479966 CTGTGTGTGTTTATGTGTGTTGG - Intergenic
1148746807 17:49922953-49922975 TTGTGTGTGTACATGTGTCTGGG + Intergenic
1151340893 17:73470045-73470067 CTCTTTGTTTACCTGTGTGTGGG - Intronic
1151340908 17:73470352-73470374 CTTTTTGTTCACATGTGTCTGGG - Intronic
1151496169 17:74459580-74459602 CCCTTTGTGAACATGTGTTTTGG - Intergenic
1152390294 17:80000222-80000244 TTCTGTGTGGACATGAATCTTGG - Intronic
1152530043 17:80913038-80913060 GTCTGAGTGTATATGTGTGTGGG + Intronic
1153180982 18:2432723-2432745 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
1155234691 18:23807490-23807512 CTGTGTGTGTATGTGTGTGTAGG + Intronic
1155705309 18:28803109-28803131 CTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1155709084 18:28853485-28853507 TTCTTTGTGTACATGTGTTCTGG - Intergenic
1156480831 18:37435355-37435377 GTGTGTGTGCACGTGTGTCTTGG + Intronic
1157061243 18:44292996-44293018 GTCTTTGTGTACATCTTTCTTGG + Intergenic
1157300500 18:46475620-46475642 ATGTGTGTGTACATGAGTGTGGG - Intergenic
1157505540 18:48223560-48223582 CAATGTGTGCACACGTGTCTAGG - Intronic
1158112614 18:53957866-53957888 CCCTGTGTGTATATATCTCTGGG - Intergenic
1158533954 18:58291009-58291031 CTCTGTGTGACCATGTGGGTCGG - Intronic
1158533961 18:58291047-58291069 CTCTGTGTGACCATGTGGGTCGG - Intronic
1158533990 18:58291183-58291205 CTCTGTGTGACCATGTGGGTTGG - Intronic
1159581718 18:70240779-70240801 CTCTCTGTGTATTTGTGTATAGG - Intergenic
1159677215 18:71299819-71299841 CTGTGTGTATATATGTGTGTGGG + Intergenic
1160686038 19:437020-437042 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1160999707 19:1904414-1904436 CTCTGTGTGTTCATGAATTTTGG - Intergenic
1161614777 19:5263994-5264016 ATCTGTGGGTCCATCTGTCTGGG - Intronic
1161876152 19:6911842-6911864 GTATGTGTGTAAATGTGTGTGGG - Intronic
1161876155 19:6911871-6911893 GTATGTGTGTAAATGTGTGTGGG - Intronic
1161876158 19:6911896-6911918 GTATGTGTGTAAATGTGTGTGGG - Intronic
1163561895 19:18024151-18024173 TTGTGTGTGTACATGCCTCTGGG - Intergenic
1164072750 19:21783736-21783758 CTCTCTATGTAGATGAGTCTAGG + Intergenic
1164565102 19:29320172-29320194 CTGTGTGTGTATGTGTGTGTGGG - Intergenic
1164620900 19:29695523-29695545 GTCTGGGTGTCCAGGTGTCTGGG - Intergenic
1164621143 19:29696747-29696769 GTCTGGGTGTCCAGGTGTCTGGG + Intergenic
1164749990 19:30646370-30646392 GACTGTGTGTACACGTGTCTAGG + Intronic
1164969523 19:32519503-32519525 TTCTGGGTGGACATGTCTCTTGG + Intergenic
1165070064 19:33249722-33249744 GTCTGTGTGTGCCTGTGTGTTGG - Intergenic
1165305710 19:35001134-35001156 AAGTGTGTGTACGTGTGTCTGGG + Intronic
1165543514 19:36512881-36512903 CTCCCTGTGTTCATGTTTCTTGG + Exonic
1165883762 19:39062398-39062420 CTCTGGGTGTACAGGCGCCTGGG + Intergenic
1166301842 19:41915488-41915510 CTCTGTGTCCCCATGTCTCTGGG + Intronic
1166326717 19:42055359-42055381 CTCTGCGCGTAGAAGTGTCTTGG + Intronic
1166721097 19:44996417-44996439 CTGGATGTGTTCATGTGTCTGGG - Intergenic
1166776807 19:45318052-45318074 GCCTGTGTGGACATGTGTGTCGG + Intronic
1167249823 19:48393875-48393897 ATCTGTGTGTCCGGGTGTCTGGG + Intergenic
1167675918 19:50885462-50885484 CTCTGTGTGTGCATGTACATGGG + Intergenic
1167924018 19:52809014-52809036 ATATGTGTGTGCATGTGTGTGGG + Intronic
1167929187 19:52850104-52850126 ATATGTGTGTGCATGTGTGTGGG + Intronic
1168011632 19:53538034-53538056 GTCTGTGTGCACATGCGTGTCGG + Intronic
1168556228 19:57343143-57343165 ATCTTTGTGTACATGTATTTTGG - Intergenic
925040363 2:728128-728150 GCATGTGTGTACATGTGTGTGGG + Intergenic
925149374 2:1604097-1604119 GTCTGTGTGTGTATGTGTGTAGG - Intergenic
925922935 2:8649389-8649411 GTATGTGTGTATATGTGTATAGG + Intergenic
926631907 2:15144170-15144192 CACTGTGTGTGCATATGTGTTGG - Intergenic
926753088 2:16214746-16214768 TTCTGTCTGGACAAGTGTCTAGG - Intergenic
927040118 2:19220861-19220883 GTCTGTGTGTTCGTGTGTGTTGG + Intergenic
927989219 2:27435625-27435647 ATTTGTGTGTCCATTTGTCTGGG + Intronic
928171301 2:29005189-29005211 GTGTGTGTGTGCATGTGTGTGGG + Intronic
928222373 2:29415050-29415072 GTGTGTGTATACATGTGTGTGGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929795786 2:45057395-45057417 GTGTGTGTGTACCTGTGTGTGGG + Intergenic
929938052 2:46309240-46309262 CACTGTGTGTAGATGTTTATAGG + Intronic
930540434 2:52699199-52699221 ATGTGTGTGCACATGTGTCCTGG + Intergenic
930852814 2:55979175-55979197 CTTTGTGTATATATGTGTTTAGG + Intergenic
931061504 2:58534388-58534410 CTCTGTGTGTGCGTGTGGCTTGG + Intergenic
932224748 2:70030712-70030734 CTCTGTATGTGTATGTGTGTTGG + Intergenic
932429029 2:71662571-71662593 TTGTGTGTATACATGTGTGTAGG + Intronic
933065392 2:77787370-77787392 TTTTGTGTGTATATGTGTGTAGG - Intergenic
933239688 2:79906232-79906254 CTGTGTGTGTATGTGTGTATGGG - Intronic
933431584 2:82186768-82186790 CTCTGTGTGTATGTGTGTTTGGG - Intergenic
933724433 2:85418591-85418613 CTGTGTGTGTAAGTGTGTCCGGG - Intergenic
934752416 2:96801754-96801776 CTCTGTCTGTGTGTGTGTCTGGG - Intronic
934971753 2:98769868-98769890 GTTTGTGTGGACATGTGACTCGG + Intergenic
935035464 2:99367885-99367907 TTCTGTGTGAACATTTCTCTTGG - Intronic
935578465 2:104735087-104735109 TTCTTTGTGTGCATGTGTGTGGG - Intergenic
935600651 2:104918529-104918551 CCCTGTGTGTACCTGTGTTCAGG - Intergenic
936635380 2:114250282-114250304 CTCTGTGTGTGTGTGTGTGTTGG + Intergenic
936937397 2:117851531-117851553 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
937288837 2:120769763-120769785 TTCTGAGTGTGCATGTGTTTGGG + Intronic
937702912 2:124884247-124884269 CTCTCTGTGTGTATGTGTATGGG + Intronic
937717936 2:125056283-125056305 GTGTGTGTGTACATGTGATTTGG - Intergenic
938084062 2:128386636-128386658 CTCTGTGTGTGCATCTGGTTCGG + Intergenic
939014718 2:136888973-136888995 GTGTGTGTGTACATGTATTTAGG + Intronic
939178151 2:138774640-138774662 CTGTGAGTGTGTATGTGTCTTGG - Intronic
941704801 2:168646605-168646627 CTTTGTGTGTTCCTGTGTCCAGG + Intronic
942512076 2:176713367-176713389 CTTTGTGTCTACATCTGTGTAGG + Intergenic
942639122 2:178042042-178042064 CTCTGTTTCTAAATGGGTCTAGG + Intronic
943515777 2:188884501-188884523 CTTTGTGTGTATATTTGTTTGGG - Intergenic
943662164 2:190570689-190570711 CTTTGTGTGGACATGTGACTAGG - Intergenic
945924983 2:215794254-215794276 GACTGTGTGTACTTGTGTTTGGG + Intergenic
946414970 2:219535360-219535382 CTCTGTGTGTACGTGTGTGTGGG + Intronic
946418156 2:219550912-219550934 CTCTTTGTGTACTGGTGTCCAGG - Intronic
946449457 2:219767351-219767373 CTGTGTGTGTGCATGTGTGTGGG + Intergenic
947591706 2:231389612-231389634 GTGTGTGTGTTCATGCGTCTGGG + Intergenic
947856728 2:233329126-233329148 CTGTGTGTATACACGTGTGTGGG + Intronic
947945075 2:234094102-234094124 CTCTGTTTGGACATGTTTTTTGG - Intergenic
948256951 2:236575383-236575405 TGCTGTGTGTGCGTGTGTCTGGG + Intronic
948256954 2:236575412-236575434 CTGTGTGTGTGTGTGTGTCTGGG + Intronic
948256957 2:236575439-236575461 TGCTGTGTGTGCGTGTGTCTGGG + Intronic
948256960 2:236575466-236575488 TGCTGTGTGTGCGTGTGTCTGGG + Intronic
948256966 2:236575520-236575542 TGCTGTGTGTGCGTGTGTCTGGG + Intronic
948256969 2:236575549-236575571 CTGTGTGTGTGTGTGTGTCTGGG + Intronic
948256972 2:236575576-236575598 TGCTGTGTGTGCGTGTGTCTGGG + Intronic
948256975 2:236575605-236575627 CTCTGTGTGTGTGTGTGTCTGGG + Intronic
948354219 2:237364835-237364857 GTGTGGGTGTACATGTGTGTGGG + Intronic
948354221 2:237364861-237364883 GTATGTGTGTGCATGTGTATGGG + Intronic
948429530 2:237910209-237910231 CTGTGTGTGTCCCTGTGTGTGGG - Intronic
948429534 2:237910245-237910267 CTGTGTGTGTCCCTGTGTGTGGG - Intronic
948661378 2:239508708-239508730 CTCTGTATGGACGTGTGTGTGGG + Intergenic
948679684 2:239625440-239625462 CTAAGTGTGTCCATGTGTGTTGG - Intergenic
948692187 2:239713137-239713159 GTGTGTGTGTGAATGTGTCTGGG + Intergenic
948794076 2:240393249-240393271 ATGTGTGTGTACGTGTGTCAAGG - Intergenic
948950900 2:241250701-241250723 CTCTGCGTGTGCATGTGTTTGGG - Intronic
949059839 2:241950458-241950480 GTCTGTGTGTGCGTGTGTTTGGG + Intergenic
1171335129 20:24378420-24378442 ATTTGTGTGTACATATGTGTGGG + Intergenic
1172353737 20:34264162-34264184 GTCTGTGTGTACATATGTTTTGG - Intronic
1172485530 20:35295855-35295877 CTGTGTGTGCATGTGTGTCTGGG + Intergenic
1172881058 20:38200227-38200249 CCTTGTATGTACATGGGTCTAGG + Intergenic
1173503708 20:43571213-43571235 GTATGTGTGTACATGTGCATGGG - Intronic
1173750628 20:45472575-45472597 ACCTATGTGTGCATGTGTCTTGG + Intronic
1175230335 20:57469820-57469842 CTCTGTGTGTGCGTGTGTGTAGG - Intergenic
1175744355 20:61444947-61444969 ATCTGTGTGTATATGTGTGTGGG + Intronic
1175981825 20:62742601-62742623 CCCTGTGTAAACAGGTGTCTGGG - Intronic
1176176891 20:63732289-63732311 GTGTGTGTGTGCATGTGTGTGGG + Intronic
1176176900 20:63732346-63732368 GTGTGTGTGTGCATGTGTCAGGG + Intronic
1176371953 21:6067588-6067610 CTCTGTGGGTTCATGTGCTTCGG - Intergenic
1177956021 21:27600437-27600459 CACTGTCTGCACATGTATCTTGG - Intergenic
1178322662 21:31617214-31617236 GTGTGTGTGTACATGTGTGGCGG - Intergenic
1178429623 21:32508045-32508067 CTGTGTGTGTAAGTGTGTGTTGG + Intronic
1178489643 21:33041139-33041161 CTCTGTCTCTGCATGTATCTGGG - Intergenic
1178630009 21:34251495-34251517 ATGTGTGTGCACATGGGTCTGGG + Intergenic
1178681405 21:34675362-34675384 CTCTCTGTGGACATGTCACTGGG + Intronic
1179103824 21:38380548-38380570 CTCTGTTTGTCCCTGTCTCTTGG - Exonic
1179191441 21:39125671-39125693 GTGTGTGAGTACATGTGTGTTGG - Intergenic
1179427207 21:41291170-41291192 CTCTGTGTGTGTGTGTGTGTGGG - Intergenic
1179731280 21:43369026-43369048 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1179751566 21:43470951-43470973 CTCTGTGGGTTCATGTGCTTCGG + Intergenic
1181105661 22:20573540-20573562 CTCTCTGGGTAGATGTGTGTTGG + Intronic
1181290848 22:21791890-21791912 TTCTTTGTGTGCATGTGTGTGGG - Intronic
1181433376 22:22896130-22896152 CTCTGTCTGGTCATGTGTCTGGG + Intergenic
1181488165 22:23244689-23244711 CTCAGTAAGTACATTTGTCTGGG + Intronic
1181821308 22:25477796-25477818 CTCTGTGTGGTCCTGAGTCTAGG - Intergenic
1181914788 22:26271077-26271099 CTTTGGGTGCACATGTGTCTGGG + Intronic
1181936515 22:26442693-26442715 CTGTGTGTGTATATGTGTTATGG - Intronic
1182829742 22:33295348-33295370 ATGTGTGTGTACATGCGTGTGGG + Intronic
1182948818 22:34352001-34352023 TTGTGTGTGTGCATGTGTGTTGG + Intergenic
1183103947 22:35602652-35602674 CTGTGTGTGTGCGTGTCTCTGGG - Intergenic
1184833410 22:47005887-47005909 GTCTGTGTATAGATGTGTGTAGG - Intronic
1185285656 22:49998837-49998859 GTATGTGTGTGCATGTGTATGGG + Intronic
1185285660 22:49998885-49998907 ATGTGTGTGTGCATGTGTATGGG + Intronic
949309716 3:2683315-2683337 GTGTGTGTGTACATGTGTGCAGG - Intronic
949407452 3:3729467-3729489 CTGTGTGTGTGTATGTGTGTGGG - Intronic
950662354 3:14474350-14474372 TTCTGTGTGTGCGTGTGTTTGGG + Intronic
950885282 3:16357213-16357235 CACTGTGTGTACAAGAGACTAGG + Intronic
950974279 3:17224540-17224562 CTCAGTGGCTACATGTGGCTAGG + Intronic
951103634 3:18717904-18717926 CTCTGTGTTTGCTTGTTTCTTGG - Intergenic
951980122 3:28556629-28556651 CTCTGTGTTGGCCTGTGTCTTGG + Intergenic
952094735 3:29936363-29936385 CACTGTGAGTACATGTGCCCTGG - Intronic
953004838 3:38968581-38968603 GTGTGTGTGCACATGTGTGTTGG - Intergenic
953046253 3:39296273-39296295 CTCTGTGTGGAAATGAGACTGGG - Intergenic
953412899 3:42700246-42700268 CTCTCTGTGTGTGTGTGTCTGGG + Intronic
953758482 3:45667595-45667617 CTGTGTGTGTGTATGTGTTTAGG + Intronic
955651916 3:61203861-61203883 CTCTGTGAGTACATGTGTAAGGG - Intronic
955817834 3:62864608-62864630 CTCCGTGTGTGCATATCTCTGGG + Intronic
956644066 3:71439288-71439310 TTCTGTGTGTCCATGTGCATAGG + Intronic
956992540 3:74783965-74783987 CTTTGTGTGTATATTTGGCTAGG - Intergenic
957046626 3:75379870-75379892 CTGTGTGTGTAAGTGTGTGTTGG - Intergenic
957669216 3:83279645-83279667 GTCTGTGTGTATATGTGTTAAGG - Intergenic
957795530 3:85000819-85000841 CTATGTATGTACATTTGTATAGG + Intronic
959639736 3:108619268-108619290 CTGTGTGTGTGTATGTGTGTGGG + Intronic
960348788 3:116568278-116568300 CTGTGTGTGTATGTGTTTCTTGG - Intronic
961406554 3:126683791-126683813 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961406557 3:126683817-126683839 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961664009 3:128485351-128485373 CTCTGTATGTGCATGTGTTTGGG - Intronic
962281269 3:134053709-134053731 CTCTGGATGTTTATGTGTCTAGG + Intergenic
962467301 3:135672796-135672818 CTCTCTGTGTGGATGTGGCTGGG - Intergenic
962662884 3:137622348-137622370 CACTGTGTGAAAATTTGTCTAGG + Intergenic
963145919 3:141994163-141994185 TTGTGTTTGTACATGTGTGTAGG + Intronic
963152912 3:142065488-142065510 CTCTGTGTGTGTGTGTGTGTGGG + Intronic
964279635 3:155050025-155050047 CTCTTTGTGTCCATGTGTTCTGG + Intronic
965510595 3:169564836-169564858 CTCTGTGAGTATGTGTGTCCAGG - Intronic
966656948 3:182369795-182369817 TTGTGTGTGTGCATGTGTATAGG + Intergenic
968703653 4:2068242-2068264 ATGTGTGTGTACACGTGTATAGG + Exonic
968955089 4:3714574-3714596 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
968990918 4:3910981-3911003 CTTTGTGTGTAAGTGTGTGTTGG - Intergenic
969539913 4:7781801-7781823 GTCTGTGTGTGTATGTGTGTGGG - Intronic
969581810 4:8069817-8069839 GTCTGTGTGTACGTGTCTGTGGG + Intronic
970425325 4:15940577-15940599 GTATGTGTGTGAATGTGTCTAGG - Intergenic
970692659 4:18637633-18637655 ATGTGTGTGTACATGTATCTTGG + Intergenic
970946032 4:21692931-21692953 CCCTATGTGTAAATGTGGCTGGG + Intronic
971869995 4:32222439-32222461 TTTTGTTTGTACATGTTTCTCGG - Intergenic
972889623 4:43540606-43540628 CTCTGTGTGTTCATGTGAGTAGG + Intergenic
974483443 4:62475496-62475518 CTCTGTGTACACAGGTGTGTAGG - Intergenic
974913345 4:68149321-68149343 CTCTGGGAGTTCAGGTGTCTTGG + Intergenic
974913698 4:68153601-68153623 GTGTGTGTGTCCATGTGTATGGG + Intergenic
975665618 4:76732248-76732270 GTATGTGTGTGCATGTGTGTTGG + Intronic
976337956 4:83912464-83912486 GTGTGTGTGTGCATGTGTATTGG - Intergenic
976689763 4:87856097-87856119 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
977132967 4:93266469-93266491 CTGTGTGTGTATGTGTGTGTGGG - Intronic
978026622 4:103883758-103883780 GTGTGTGTGTATATGTGTTTTGG + Intergenic
978719619 4:111893040-111893062 CTCTGTGTGTGTGTGTGTATTGG + Intergenic
978856389 4:113399286-113399308 GTGTGTGTATACATGTGTATAGG - Intergenic
978865647 4:113506912-113506934 ATCTGTGTGTGAATGTGTGTAGG - Intronic
979122107 4:116916579-116916601 CTGTGTTTGTATATGTGTTTAGG + Intergenic
979279258 4:118846911-118846933 CTGTGTGTGTCCGTGTGTGTGGG - Intergenic
980077841 4:128312693-128312715 CTCTGATTATAAATGTGTCTGGG - Intergenic
980354686 4:131725659-131725681 GTCTGTGTGTGCGTGTGCCTTGG + Intergenic
980355217 4:131728136-131728158 GTCTGTGTGTGCTTGTGCCTCGG + Intergenic
980355765 4:131730637-131730659 GTCTGTGTGTGCTTGTGCCTCGG + Intergenic
980356305 4:131733128-131733150 GTCTGTGTGTGCTTGTGCCTCGG + Intergenic
980356841 4:131735616-131735638 GTCTGTGTGTGCTTGTGCCTCGG + Intergenic
980357381 4:131738108-131738130 GTCTGTGTGTGCTTGTGCCTCGG + Intergenic
980357921 4:131740597-131740619 GTCTGTGTGTGCTTGTGCCTCGG + Intergenic
980358457 4:131743089-131743111 GTCTGTGTGTGCTTGTGCCTCGG + Intergenic
980358993 4:131745561-131745583 GTCTGTGTGTGCTTGTGCCTCGG + Intergenic
980359532 4:131748032-131748054 GTCTGTGTGTGCTTGTGCCTCGG + Intergenic
980360079 4:131750524-131750546 GTCTGTGTGTGCTTGTGCCTCGG + Intergenic
980360615 4:131752999-131753021 GTCTGTGTGTGCTTGTGCCTCGG + Intergenic
980361158 4:131755479-131755501 GTCTGTGTGTGCTTGTGCCTCGG + Intergenic
980361698 4:131757954-131757976 GTCTGTGTGTGCTTGTGCCTCGG + Intergenic
980362241 4:131760434-131760456 GTCTGTGTGTGCTTGTGCCTCGG + Intergenic
980362785 4:131762917-131762939 GTCTGTGTGTGCTTGTGCCTCGG + Intergenic
980377959 4:131975600-131975622 GTCTGTGTGTTCGTGTGCCTTGG - Intergenic
980378491 4:131978076-131978098 GTCTGTGTGTGCGTGTGCCTTGG - Intergenic
980474500 4:133294943-133294965 GTGTGTGTGCACATGTGTGTTGG + Intergenic
981567115 4:146113462-146113484 CTCTATGTGTGCGTTTGTCTGGG + Intergenic
981691132 4:147510245-147510267 CTCTGGGTTTGCAGGTGTCTAGG + Intronic
982059334 4:151587927-151587949 CTCTGTGTGTATATATTTTTGGG - Intronic
982499947 4:156141392-156141414 CCCTGTGTGTATATGTGAGTGGG - Intergenic
982978003 4:162091448-162091470 CTCAGTCTGAACAAGTGTCTGGG + Intronic
983280132 4:165670321-165670343 CTGTGTGTGTATGTGTGTGTAGG + Intergenic
984832345 4:183987337-183987359 CTCTGTGTGTGTGTGTGTGTCGG + Intronic
985208778 4:187569856-187569878 CTCTGTGTCTTTATGTGACTCGG + Intergenic
985450961 4:190062126-190062148 CTCTTTGTGCACTAGTGTCTTGG + Intergenic
985706172 5:1402577-1402599 CTCCGTGTGCACGTGTGTGTGGG - Intronic
985833784 5:2256074-2256096 CTCTGTATGTGCATGTGTGTGGG + Intergenic
985833788 5:2256322-2256344 CTCTGTGTGTCTGTGTCTCTAGG + Intergenic
985874158 5:2582710-2582732 TTGTGTGTGTACATGTGTGTGGG - Intergenic
986034405 5:3924337-3924359 CTGAGTGTGTTCATGTGTGTGGG + Intergenic
986925620 5:12745054-12745076 GTGTGTGTGTGCATGTGTATGGG + Intergenic
988134535 5:27152925-27152947 CTATGTGTGTACACATGTCTAGG + Intergenic
988935769 5:36081586-36081608 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
989310730 5:40014301-40014323 CTGTGTGTGTGTATGTGTGTGGG - Intergenic
989719721 5:44510488-44510510 TTGTGTGTGTACTTGTGTGTAGG + Intergenic
989819287 5:45775753-45775775 CTCTGTGAGTACATGTATATGGG - Intergenic
990726541 5:58761637-58761659 GTGAGTGTGTACATGTGTGTGGG - Intronic
990819534 5:59822063-59822085 ATTTGTGTGTGCATGTGTTTTGG + Intronic
991001366 5:61786677-61786699 TTCTGTGTGAACACGTGTATTGG + Intergenic
991579674 5:68141171-68141193 GTATGTGTGTACATGTGTGCAGG - Intergenic
992177687 5:74166582-74166604 CTCTTTATGTACATGTCTCATGG - Intergenic
992953674 5:81886488-81886510 CTCTCTCTGTACATATGTATAGG - Intergenic
993268173 5:85756005-85756027 GTGTATGTGTACATTTGTCTTGG + Intergenic
993831142 5:92759597-92759619 TTGTGTGTGTATATGTGTGTTGG + Intergenic
995448638 5:112275564-112275586 CTGTGTGTGTGTATGTGTCGAGG - Intronic
995637260 5:114207827-114207849 CTCTGTGCCAACATGTCTCTCGG - Intergenic
995700920 5:114934201-114934223 TTCTCTGGGTACATGTGTCAGGG + Intergenic
996345305 5:122481473-122481495 ATCTTTGTGTGCATATGTCTGGG + Intergenic
997335522 5:133106517-133106539 GTCTGTGTGTATGTGTGTGTGGG + Intergenic
997390696 5:133512694-133512716 TTCTGAGTGTACAGGTATCTGGG - Intronic
997475844 5:134142034-134142056 ATCTCTGTGTACTTATGTCTAGG + Intronic
997646897 5:135487886-135487908 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
997728063 5:136139174-136139196 TTCTGTATGTATGTGTGTCTCGG + Intronic
998024755 5:138806209-138806231 CTCTATGTTTACATTTGTTTTGG + Intronic
998205698 5:140155493-140155515 CATTGTGTGTATATGTGTCCAGG + Intergenic
998934065 5:147215851-147215873 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
999117884 5:149180355-149180377 GTGTATGTGTACATGTGTATTGG - Intronic
999179367 5:149658106-149658128 CTCTCTGTGTAGATTTGCCTTGG - Intergenic
1000367380 5:160504414-160504436 CTGTGTGTGTATGTGTGTGTGGG + Intergenic
1000716188 5:164647355-164647377 ATATGTGTGTGCATGTGTGTAGG + Intergenic
1001533918 5:172485234-172485256 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1001842799 5:174893502-174893524 CTCTGTGTGTGTATGTGTGGTGG + Intergenic
1001953319 5:175831100-175831122 CTGTGTGTGTGTGTGTGTCTCGG + Intronic
1002056874 5:176603223-176603245 CTGTGTGTGTACATGTTTTGGGG - Intronic
1002551543 5:179997037-179997059 CTATGTTGGTATATGTGTCTGGG + Intronic
1002701229 5:181126805-181126827 TTCCGTGTGTCCATGTGTCTGGG - Intergenic
1002943428 6:1738124-1738146 CTGTGTGTGTATGTGTGTATGGG - Intronic
1003696868 6:8415807-8415829 CTAGGTGTGGTCATGTGTCTAGG + Intronic
1004624969 6:17366065-17366087 CCATGTGTTTCCATGTGTCTGGG + Intergenic
1004867301 6:19866786-19866808 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1005051339 6:21686664-21686686 TTCTGTGTGTGCATGAGTTTGGG + Intergenic
1005520183 6:26594294-26594316 TTGTGTGTGTACATATGTTTAGG - Intergenic
1005725667 6:28645307-28645329 CTGTGTGTATACATGTATATAGG + Intergenic
1005768893 6:29044853-29044875 CTCTATGTTTACATGTGGTTGGG - Exonic
1006174003 6:32110836-32110858 CCGTGTGTGTCCGTGTGTCTGGG + Intronic
1007339779 6:41183582-41183604 GTGTGTGTGAATATGTGTCTGGG - Intergenic
1007384262 6:41510049-41510071 ATGTGTGTGTACGTGTGTGTTGG - Intergenic
1007396044 6:41578448-41578470 CCCTCTGTGTTCCTGTGTCTGGG + Intronic
1007765316 6:44156364-44156386 TGCTGTGTGTGCATGTGTGTGGG - Intergenic
1007811588 6:44490132-44490154 CTGTGTGTGTCTATGTGTATAGG - Intergenic
1008128496 6:47694544-47694566 CTCTGTGAGTCCATCTCTCTGGG - Intronic
1008248645 6:49209327-49209349 GTGTGTGTGTGCGTGTGTCTGGG - Intergenic
1008526902 6:52416761-52416783 GGCTGTGTGTGCATGTGTCCTGG - Intergenic
1009995575 6:70891776-70891798 GTGTGTGTGTACATGTAACTTGG + Intronic
1011186412 6:84681495-84681517 CTTTCTGTGTGCCTGTGTCTCGG + Intergenic
1011595298 6:89010230-89010252 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1012107415 6:95180930-95180952 GTCTGTGTGTATGTGTGTGTGGG - Intergenic
1012165122 6:95939730-95939752 GTGTCTGTGTACTTGTGTCTCGG + Intergenic
1013000485 6:106017431-106017453 CTCTGTGTGTGTCTGAGTCTGGG + Intergenic
1013095807 6:106943986-106944008 CTTTTTGAGTACTTGTGTCTTGG + Intergenic
1013486912 6:110606077-110606099 ATGTGTGTGTATGTGTGTCTGGG - Intergenic
1014499480 6:122167487-122167509 CTATGTGTGTATATGTGTGTTGG + Intergenic
1014643552 6:123944952-123944974 GTCTGTGTGTGCATGTGTGTTGG - Intronic
1014671957 6:124315262-124315284 CACTTTGTGGCCATGTGTCTGGG - Intronic
1015691717 6:135931794-135931816 ACATGTGTGTACATGTGTATGGG + Intronic
1015696095 6:135981551-135981573 CACTGTGTGCATTTGTGTCTCGG - Intronic
1016642144 6:146361342-146361364 CTTTGGCTGTACTTGTGTCTTGG - Intronic
1016962980 6:149691246-149691268 CTCTGCATGTGCATGTGTCTGGG - Intronic
1017822096 6:158056968-158056990 CTCTGTGTGGTGATGAGTCTCGG + Intronic
1018516563 6:164586114-164586136 CTTTATGTGTAAATATGTCTAGG + Intergenic
1018765590 6:166930541-166930563 CTCTGTGTGAACATGCATGTGGG - Intronic
1018773948 6:166997875-166997897 CTCTGTGTGTTCCTGTATGTGGG - Intergenic
1018807837 6:167275101-167275123 ATCTGTGTTTTCAGGTGTCTGGG + Intronic
1019116468 6:169767707-169767729 CTGTGTGTGTATATGTGGCATGG - Intronic
1019129594 6:169864043-169864065 CTGTGTGTGTGCCTGTGTGTGGG - Intergenic
1019352442 7:561197-561219 GCCTGTGTGTGCATGTGTGTGGG - Intronic
1021239244 7:18180216-18180238 GTGTGTGTGTGTATGTGTCTTGG - Intronic
1021280320 7:18708919-18708941 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1022957805 7:35397505-35397527 GTGTGTGTGCACATGTGTGTGGG + Intergenic
1023153222 7:37222035-37222057 TTCTGTGTGTGGATGTGGCTGGG - Intronic
1023162587 7:37311673-37311695 CTGTGGGTGTGCATGTGTCACGG - Intronic
1023379372 7:39591105-39591127 CTTTGTGTGCACATGTGTTGGGG + Intronic
1023648747 7:42346409-42346431 GTCAGTGTGTACATGTATTTAGG - Intergenic
1024008291 7:45243364-45243386 TTTTTTGTGTACGTGTGTCTGGG + Intergenic
1024534977 7:50422931-50422953 CTGAGTGTGTACATGTAGCTGGG - Intergenic
1024854036 7:53755874-53755896 GTGTGTGTGTGCATGTGTCTGGG - Intergenic
1027052099 7:75027051-75027073 CTGTGTGTGCACACGTGTATGGG + Intergenic
1027505210 7:79008781-79008803 CCCTGTGTTTCCATGTGTCTTGG + Intronic
1027749190 7:82120199-82120221 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1028021867 7:85786702-85786724 CTCTGTGTGTTGTTCTGTCTTGG - Intergenic
1028224179 7:88230921-88230943 CTGTGTGCGTGCATGTGTGTGGG - Intergenic
1028484698 7:91344864-91344886 GTCATTGTGTACATGTGTTTTGG - Intergenic
1028863357 7:95679710-95679732 TTCTGTGTGCCCATGTTTCTAGG + Intergenic
1029051223 7:97690225-97690247 CTCAGTGTGCATATGTGTGTGGG - Intergenic
1029423853 7:100484862-100484884 CTCTGTCTGTAGATGTGGGTCGG + Intronic
1030167173 7:106566930-106566952 CTGTGTGTGTACATCTGTATGGG - Intergenic
1030422772 7:109329400-109329422 CTAGGTGAGTTCATGTGTCTAGG + Intergenic
1031814741 7:126419905-126419927 CTGTGTGTGTCTATGTGTGTGGG - Intergenic
1032013438 7:128361169-128361191 CTGTGTGTGTGAATGTGTGTAGG - Intronic
1032366319 7:131303348-131303370 CTCAGTGTTCACCTGTGTCTTGG + Intronic
1032698689 7:134359842-134359864 CTCTTTGTGTGCATGTGTACAGG - Intergenic
1033560911 7:142529494-142529516 CTCTTTGTGATCTTGTGTCTGGG - Intergenic
1033579462 7:142718300-142718322 CTTTTTGTTTACCTGTGTCTCGG + Intergenic
1033593034 7:142830270-142830292 ATCTGTGTGTATGTGTGTGTGGG - Intergenic
1034032538 7:147784097-147784119 CTCTCTTTGTGCATGTCTCTGGG + Intronic
1035112909 7:156498108-156498130 ATCTGTGTGTGTGTGTGTCTGGG - Intergenic
1035112919 7:156498468-156498490 CTATCTGTGTGCGTGTGTCTGGG - Intergenic
1035541118 8:439071-439093 CTCTGTGTTTACAGCTGTCCTGG - Intronic
1035907031 8:3523542-3523564 ATCTGTGTGCACATGTGTCTGGG - Intronic
1035907034 8:3523630-3523652 GCCTGTGTGTGCACGTGTCTCGG - Intronic
1036240512 8:7076815-7076837 TTCTGTGTGTAGGTGTGTGTGGG - Intergenic
1036832441 8:12031751-12031773 TTTTGTGTGTAGGTGTGTCTGGG + Intergenic
1036902617 8:12682276-12682298 TTTTGTGTGTAGGTGTGTCTGGG + Intergenic
1037007743 8:13803533-13803555 CTCTCTGTGTGCCTCTGTCTTGG + Intergenic
1037925010 8:22837591-22837613 GTCTGTGTGGGCATGTGTATGGG - Intronic
1039254823 8:35707465-35707487 ATATGTGTGTTCATGTGTATGGG + Intronic
1039442394 8:37604214-37604236 ATGTGTGTGTGCATGTGTGTTGG - Intergenic
1039583257 8:38683869-38683891 GTCTGTGTGTGCATGTGTTGAGG - Intergenic
1039784451 8:40820789-40820811 CTGTGTGTGTATATATGTGTGGG + Intronic
1041848075 8:62354840-62354862 CTCTGCCTGTACATGTATCAGGG - Intronic
1042622495 8:70722185-70722207 CTATGTGTGCACATGAGGCTGGG + Intronic
1042921082 8:73920438-73920460 TTGTGTGTGTATATGTGTTTAGG - Intergenic
1043501965 8:80867163-80867185 CTCTGTGTATACGTGTCCCTTGG + Intronic
1043521379 8:81049354-81049376 CTTTTTGTGTACATGTGAATAGG - Intronic
1043696683 8:83228226-83228248 TTGTGTGTGTCCATGTGTGTGGG + Intergenic
1044520188 8:93190097-93190119 CCCTGTGTATGCATGTGTTTTGG - Intergenic
1044719471 8:95131956-95131978 TTCTGTGTGTATGTGTGACTGGG + Intergenic
1045487368 8:102642184-102642206 CTCTGTGTGTGTGTGTGTCGGGG - Intergenic
1045878386 8:107009772-107009794 GTGTGTGTGTATATGTGTGTGGG - Intergenic
1046970426 8:120216864-120216886 CTCTGTTTGGACATGGGTCATGG - Intronic
1047544957 8:125806848-125806870 CTCTGTGTGTGCATGTTTGTGGG + Intergenic
1047617801 8:126577437-126577459 GTGTGTGTGTATATGTGTGTTGG - Intergenic
1048281951 8:133112321-133112343 CTATGTGTTTACATATTTCTAGG - Intronic
1048369933 8:133768451-133768473 TTCTCTGTGTGCATGTGTCCCGG - Intergenic
1048452391 8:134544939-134544961 CTCTGTGGGTGTATGTATCTTGG + Intronic
1049119849 8:140725688-140725710 CACTGTGTGTGCATGATTCTAGG - Intronic
1049159497 8:141088253-141088275 GTGTGTGTGTGCATGTGTATGGG - Intergenic
1049298056 8:141854395-141854417 CTCTGTGTGTGCATATGTGTGGG - Intergenic
1049525440 8:143123569-143123591 ATGTGTGTTTACATGTGTCATGG - Intergenic
1051166999 9:14273515-14273537 AGCTGTGTGTCAATGTGTCTGGG - Intronic
1053343863 9:37363590-37363612 TTCTGTGTCTCCTTGTGTCTTGG + Intergenic
1053547729 9:39041489-39041511 CTGTGTGTGTGTATGTGTGTAGG - Intergenic
1053797292 9:41738446-41738468 CTCTGTGTTTAAATCTATCTAGG + Intergenic
1053874236 9:42526346-42526368 GTGTGTGTGTACATGTGTGTGGG + Intergenic
1054185706 9:61950513-61950535 CTCTGTGTTTAAATCTATCTAGG + Intergenic
1054268097 9:62940408-62940430 GTGTGTGTGTACATGTGTGTGGG - Intergenic
1054323827 9:63703256-63703278 GTCTGTGTGTGCATGCGCCTTGG - Intergenic
1054467644 9:65507575-65507597 CTCTGTGTTTAAATCTATCTAGG - Intergenic
1055196122 9:73596342-73596364 CTTTGTGTGTATATGTGTGTAGG - Intergenic
1055834682 9:80424853-80424875 TTCTGTGTGTTCAGGTGTGTGGG + Intergenic
1055943183 9:81669624-81669646 CTCTTTGTGTGCATGTCTTTTGG - Intronic
1056456438 9:86765565-86765587 CTGAGTGTGTGGATGTGTCTGGG + Intergenic
1056761241 9:89416589-89416611 ATCTGTGTGTCCCTGTGTGTAGG - Intronic
1056778969 9:89535105-89535127 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056778971 9:89535129-89535151 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056778980 9:89535249-89535271 CTGTGTGTGTGTATGTGTATAGG + Intergenic
1057023821 9:91721170-91721192 CTCTGTGTTTATTTGTGTGTGGG + Intronic
1057449506 9:95144185-95144207 CGCTGTGTCAACATGTGGCTGGG + Intronic
1057971157 9:99559060-99559082 TTCTGTGTGTTCATGAGTCCTGG + Intergenic
1058447527 9:105067002-105067024 CTCAGTGTGCACCTGTTTCTTGG - Intergenic
1059902926 9:118948421-118948443 CTCTGTGTGTATGTGTCTTTGGG + Intergenic
1060227836 9:121806629-121806651 GTATGTGTGTACATGTGTGAGGG + Intergenic
1060613284 9:124988060-124988082 GTATGTGTGTGCATGTGTGTAGG - Intronic
1060718825 9:125960067-125960089 CTCTGTGTTTACATTTGACCTGG + Intronic
1060942210 9:127549470-127549492 GTGTGAGTGTACATGTGTGTGGG - Intronic
1061209963 9:129185667-129185689 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1061295259 9:129673613-129673635 CTGTGTGTGTCTTTGTGTCTGGG - Intronic
1062563644 9:137153649-137153671 TGCTGTGTGTACATGTATGTAGG - Intronic
1185589824 X:1268631-1268653 GTGTGTGTGTAGATGTGTGTGGG + Intergenic
1185615129 X:1417112-1417134 GTGTCTGTGTGCATGTGTCTGGG - Intronic
1186084483 X:5972191-5972213 GTTTGTGTGTGCATGTGTGTGGG + Intronic
1186448022 X:9648506-9648528 CTCTGGGTGTACATGTGGGGAGG - Intronic
1186682656 X:11892073-11892095 ATATGTGTGTACATATGTTTAGG + Intergenic
1186930650 X:14385622-14385644 CTCTGTGTATTCAAGTGACTTGG + Intergenic
1186949793 X:14611453-14611475 TTCTGTGTGTGCATGTGCATGGG - Intronic
1188998227 X:36912488-36912510 CTCTGTGTGTATGTATGTGTAGG - Intergenic
1189100105 X:38180158-38180180 GTATGTGTGTATATGTGTGTTGG - Intronic
1189436815 X:41000276-41000298 CTTTGTGTGGACATATGTTTTGG + Intergenic
1189549228 X:42076027-42076049 CTGTGTGTGTATGTGTGTGTGGG + Intergenic
1189631256 X:42956099-42956121 ATGTGTGTGTGTATGTGTCTTGG + Intergenic
1189916187 X:45857973-45857995 CTCTGAGAGTAAATGTGTCTCGG - Intergenic
1190254942 X:48755275-48755297 CTGTGTGTGTACATGTGGTTGGG - Intergenic
1192239780 X:69319870-69319892 CTATGTGTGTTCATGCGGCTGGG + Intergenic
1193461929 X:81800781-81800803 TTGTGTGTGTGCATGTGTGTCGG + Intergenic
1194880793 X:99249549-99249571 CTTTGTGTGTGCATGTGTTGTGG + Intergenic
1194904527 X:99558201-99558223 CTCTGTGAGCACATGTGCCTTGG - Intergenic
1195115439 X:101693749-101693771 ATCAGTGTGTACGTGTGTCGGGG - Intergenic
1195239409 X:102936201-102936223 CTCTGTGTGTGTCTGTGTATGGG - Intergenic
1195298298 X:103501860-103501882 CTCTGTGTGTGTCTGTGTATGGG + Exonic
1195424322 X:104711353-104711375 CTCTTTGTGTGCATGTGTACAGG + Intronic
1195712229 X:107782386-107782408 CTATGTGTGTATATATGTGTGGG - Intronic
1199382963 X:147191800-147191822 CTCTGTGTGTGTGTGTGTGTGGG + Intergenic
1199548501 X:149032843-149032865 CTGTGTGTGTGTATATGTCTAGG + Intergenic
1199682603 X:150237387-150237409 CTCTCCGTGTGCCTGTGTCTGGG - Intergenic
1199844933 X:151685467-151685489 CCCTGCTTGTACATGCGTCTTGG - Intergenic
1199881594 X:151977714-151977736 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1200333879 X:155327188-155327210 ATCTGTATGTATGTGTGTCTTGG - Intronic