ID: 1076538596

View in Genome Browser
Species Human (GRCh38)
Location 10:131199039-131199061
Sequence CAAGATCTCATGGGCACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076538588_1076538596 -6 Left 1076538588 10:131199022-131199044 CCCTGCGCAGTGAGCCCCAAGAT 0: 1
1: 0
2: 4
3: 16
4: 96
Right 1076538596 10:131199039-131199061 CAAGATCTCATGGGCACCCTGGG No data
1076538589_1076538596 -7 Left 1076538589 10:131199023-131199045 CCTGCGCAGTGAGCCCCAAGATC 0: 1
1: 0
2: 2
3: 13
4: 85
Right 1076538596 10:131199039-131199061 CAAGATCTCATGGGCACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076538596 Original CRISPR CAAGATCTCATGGGCACCCT GGG Intronic
No off target data available for this crispr