ID: 1076540695

View in Genome Browser
Species Human (GRCh38)
Location 10:131213004-131213026
Sequence GAGGGTCATTTTCAGCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076540695_1076540699 -5 Left 1076540695 10:131213004-131213026 CCCATCAGCTGAAAATGACCCTC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1076540699 10:131213022-131213044 CCCTCTCTGCCCCATCAGGCAGG No data
1076540695_1076540697 -9 Left 1076540695 10:131213004-131213026 CCCATCAGCTGAAAATGACCCTC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1076540697 10:131213018-131213040 ATGACCCTCTCTGCCCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076540695 Original CRISPR GAGGGTCATTTTCAGCTGAT GGG (reversed) Intronic
901438964 1:9265987-9266009 GAGGGTCATTTCCATCTCAGGGG + Exonic
904038264 1:27570231-27570253 CCAGGTCATTTTCAGCTGCTTGG - Intronic
905763440 1:40580348-40580370 GAGGGTCATTTGAAGCTGGGAGG + Intergenic
906698138 1:47838576-47838598 TAGGGTCAGTTACTGCTGATAGG + Intronic
908690639 1:66775644-66775666 GAGGGACATTTTTACCTGAGAGG + Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
910009491 1:82443436-82443458 GAGGGCAATTAACAGCTGATTGG - Intergenic
911604909 1:99893841-99893863 GGGGTTCATTTTAAACTGATTGG + Intronic
912067260 1:105758823-105758845 GTGGGTCATTTGCAGTGGATTGG - Intergenic
916729269 1:167552077-167552099 GTGGGACATATTCAGCTGATGGG + Intronic
917723545 1:177809079-177809101 GAGGGTAATTTTCACTTGGTGGG - Intergenic
917924088 1:179774519-179774541 GGGGATCATTCTCAGCTGCTAGG - Intronic
918378929 1:183935647-183935669 GAGGGTTGTTTTAAACTGATGGG - Intronic
918404314 1:184196317-184196339 GAGGGGCATTTAGAGCTGACTGG + Intergenic
918531597 1:185528267-185528289 CAGTGTCATTTTATGCTGATGGG + Intergenic
919485758 1:198145372-198145394 GATAGTCATTTTCAGATGCTGGG - Intergenic
920009102 1:202854915-202854937 GAGGCCCATTATCAGATGATGGG - Intergenic
1062772947 10:118784-118806 GAGGGACCTTTTGAGCTTATTGG - Intergenic
1063372336 10:5529968-5529990 GTGGGTCATTTTTAGCTGGCTGG - Intergenic
1064970406 10:21060328-21060350 GGGTTTCATTTTCAGCTAATGGG + Intronic
1069060877 10:63893165-63893187 GAGGGACATTTTCAGCACATAGG + Intergenic
1070280906 10:75047524-75047546 CAGGGGCATTTTGAGGTGATGGG + Intronic
1072087137 10:92091318-92091340 GAGGCTGATGTACAGCTGATTGG + Intronic
1076540695 10:131213004-131213026 GAGGGTCATTTTCAGCTGATGGG - Intronic
1081536230 11:43998286-43998308 GTGGGTGAAATTCAGCTGATGGG + Intergenic
1082274006 11:50201825-50201847 AGGGGTAATATTCAGCTGATAGG + Intergenic
1082613278 11:55328819-55328841 GGGGGTCATTTTCAGAAGGTTGG + Intergenic
1082829487 11:57605047-57605069 GAGGGTGTTTTTCAGATGATGGG - Intronic
1093616237 12:21228882-21228904 GTTGGTCATTTCCAGCTGGTTGG - Intronic
1094249284 12:28340945-28340967 GAAGGTAGTTTTCAGCAGATGGG + Intronic
1094400135 12:30054098-30054120 TAAAGTCATTTTCAGGTGATCGG - Intergenic
1096594593 12:52686561-52686583 GAGAGACATTTTCTCCTGATGGG + Intergenic
1099039175 12:77629760-77629782 GAATGTCATTTTCAGCAGAGGGG - Intergenic
1099697821 12:86043919-86043941 GTGGGTCATTTTGAGGTGAGAGG + Intronic
1103320472 12:120090025-120090047 GAGGTTCAGTTTCTGCTGAATGG - Exonic
1103588655 12:121974751-121974773 GAGGGTTATTTTTATCTGACTGG + Intronic
1107283526 13:38763662-38763684 AAGGTTTATTTTCTGCTGATAGG + Intronic
1107729133 13:43330702-43330724 TAAGGTCATTTACAGCTGCTGGG - Intronic
1112323921 13:98431000-98431022 GAGGGTCCTGTTCAGCTGAATGG - Intronic
1112608586 13:100932337-100932359 TAGGGTCATTGTAAGCCGATAGG - Intergenic
1114409808 14:22490054-22490076 GAGGGACATTCTCAACTGAGAGG + Intergenic
1117685132 14:58245058-58245080 GTGGGCCATTTGCAGCTGTTTGG + Intronic
1120850395 14:89164239-89164261 GAGGGTCACTTGTAGCTGAAGGG + Intronic
1123957729 15:25356812-25356834 GAGGGTCAGTTTACTCTGATTGG - Exonic
1125709889 15:41776022-41776044 GAGGATCATCTGCAGCTGAGTGG - Intronic
1126332531 15:47549064-47549086 AAAGGTCATTTTCAGCTCCTAGG - Intronic
1128775419 15:70316511-70316533 GAGGGTCTCCTTCAGCTGGTAGG - Intergenic
1129650342 15:77482393-77482415 GAGGGTGATTTTAAGTTGAAAGG + Intronic
1129654731 15:77516605-77516627 GATGGTCATGTTGAGCTGGTTGG - Intergenic
1130636046 15:85621060-85621082 GAGGGTCATTTTAAGCAAAGTGG + Intronic
1130916139 15:88306220-88306242 CAGGGGCATCTTCAGCTGATGGG + Intergenic
1133239468 16:4405674-4405696 GAGGGTCCTTTTCAGCCAAGGGG + Intronic
1133443523 16:5840446-5840468 GAAAGTCATTTTGTGCTGATAGG + Intergenic
1133556940 16:6914710-6914732 CAGGTTAATTTTCAGCTTATTGG - Intronic
1134008836 16:10836205-10836227 AAGGGTGATCTTTAGCTGATAGG - Intergenic
1139341251 16:66269671-66269693 GAGGGTCATTTCCAACTGGAGGG - Intergenic
1139626296 16:68191668-68191690 CAGCGTCATTTCCACCTGATGGG + Exonic
1145864528 17:28232218-28232240 GAGCTACATTTTCTGCTGATTGG + Intergenic
1147544756 17:41392804-41392826 GAGGGCCATTTTGATCTGAAGGG - Intronic
1149573993 17:57698296-57698318 GAGGGTCCTTGACAGCGGATGGG - Intergenic
1154348932 18:13566944-13566966 GAGGGTCCTGCTGAGCTGATGGG + Intronic
1162188041 19:8922505-8922527 TAGGGTCATATTCACCTGTTGGG + Intronic
1163176764 19:15569631-15569653 GAGGGGCAATATCAGCTGACTGG + Intergenic
1164916437 19:32056006-32056028 GTGGGTCAGATGCAGCTGATGGG + Intergenic
1166049526 19:40249626-40249648 GAGGGGCATTTACAGCTGGAGGG + Intronic
1166155826 19:40910402-40910424 CAGGGCAATATTCAGCTGATAGG - Intergenic
925555953 2:5131952-5131974 GAGGGTCAGCATCAGCTGGTTGG - Intergenic
926380330 2:12280648-12280670 GAGAGTGATTTTCTGCTGCTGGG - Intergenic
928800286 2:35081382-35081404 GAGAGTCATTTTCACATCATGGG + Intergenic
930743164 2:54854658-54854680 GAAAGTCATTTTCAGCTAACTGG + Intronic
935281465 2:101521526-101521548 CAGGGTGATTTTCAGCTCCTAGG + Intergenic
938134016 2:128739020-128739042 GTGGCTAATTTTCAGCTGACCGG + Intergenic
940638981 2:156329014-156329036 GAGGGTCATTTGCATGTGCTAGG - Intronic
941689260 2:168481516-168481538 TCGGATCATTTGCAGCTGATTGG + Intronic
942772068 2:179533559-179533581 GGGGGTCCTTTTCATGTGATTGG + Intronic
943538284 2:189180092-189180114 GAATGTCTTTTTCAGCTTATAGG - Intergenic
945167825 2:206964967-206964989 GAGGGTCTTGTACTGCTGATTGG + Intronic
947766757 2:232642808-232642830 GAGGGTCACCTCCAGCTGGTTGG + Intronic
948508377 2:238446679-238446701 TTGGGTCATTGTCAGCTGAGAGG + Exonic
1178693801 21:34775338-34775360 AAGAGTCATTTTCAGCTCTTGGG - Intergenic
1179034656 21:37749149-37749171 TGGGGTCATTTTCAGGTGACAGG + Intronic
950273989 3:11642935-11642957 GAGGGACATTCTCCGCTGTTTGG + Intronic
951089376 3:18554397-18554419 GAGGGTCATTTTCTGCCCAAAGG - Intergenic
951477064 3:23118185-23118207 GAGGGTCTTTGTCAGCATATGGG + Intergenic
953395094 3:42562727-42562749 GTGGGTCATTTTGAGCTCTTGGG - Intronic
956344676 3:68265364-68265386 GAGAGTCATTTTCACATGAAAGG - Intronic
956373533 3:68589632-68589654 GAGGCTGATTTTCAGCAGACTGG + Intergenic
956794433 3:72705023-72705045 GAGGATCATGATGAGCTGATCGG + Intergenic
963003107 3:140701731-140701753 GAGGGTCATTTCTGGCAGATAGG - Intergenic
963562668 3:146885813-146885835 GAGGGACATTGCAAGCTGATGGG + Intergenic
964902310 3:161674261-161674283 GAGGGCCATATTCATCTGAATGG + Intergenic
967822581 3:193852009-193852031 GAGGGACTTTTTCAGATGAGAGG - Intergenic
970294293 4:14612007-14612029 GAGGATCATATCCAGCTGATTGG - Intergenic
971303994 4:25464481-25464503 GAGGGTCATTGTGGGCTGAATGG + Intergenic
976224305 4:82782929-82782951 AAGGGTGATGTTCACCTGATGGG + Intronic
980742383 4:136969401-136969423 GAGTGTCATCATCAACTGATTGG - Intergenic
981482060 4:145249119-145249141 GTGGGTGATTCTCTGCTGATTGG + Intergenic
981955345 4:150465614-150465636 GATGTTCATTTTCATCTCATTGG + Intronic
982362886 4:154541372-154541394 GAGGATCCTTTTCAGCACATTGG - Intronic
986438694 5:7759596-7759618 GAGGCTCATTTTCTGCTGCAGGG + Intronic
987065544 5:14286381-14286403 GGGGGTCATTTTCAGCACCTGGG + Intronic
987223517 5:15815524-15815546 GAGAGTCATCTGCTGCTGATGGG + Intronic
988242793 5:28635043-28635065 GTGGTTCATTTGCTGCTGATAGG - Intergenic
988424549 5:31048581-31048603 CAGGGTCATTTTCTGCTTATGGG - Intergenic
990694202 5:58396834-58396856 GAGGGGCAGTGTCAGCTGGTTGG + Intergenic
991115148 5:62946369-62946391 AAGCTTTATTTTCAGCTGATAGG + Intergenic
991583195 5:68177782-68177804 GAGGTAAATTTTGAGCTGATGGG + Intergenic
995629323 5:114116225-114116247 GAGGGTCATTGCCAGAGGATGGG + Intergenic
996308184 5:122074976-122074998 GAAGGTCCTTCTGAGCTGATGGG + Intronic
997640240 5:135444197-135444219 GAGTTACATTCTCAGCTGATTGG - Exonic
1003048738 6:2761731-2761753 TAGAGTCATTTTCACCTCATAGG + Intergenic
1003399210 6:5778035-5778057 GAGGGAAATTTTCAGGTGATGGG + Intergenic
1004628792 6:17401583-17401605 GATGGACAGTTTCAACTGATTGG + Intronic
1007814274 6:44509436-44509458 GAGTGTTATTTACAGATGATGGG + Intergenic
1009582588 6:65556139-65556161 GGGGGTCATTTTCACATTATTGG + Intronic
1011476512 6:87754097-87754119 ATGGGACATTTTCAGATGATGGG - Intergenic
1012846342 6:104394253-104394275 GAGGATGCTATTCAGCTGATAGG + Intergenic
1015723089 6:136266409-136266431 GATGGGCATTTTCTGCTGTTTGG - Intronic
1018736708 6:166691990-166692012 GAGGGAGGATTTCAGCTGATGGG - Intronic
1022116072 7:27261753-27261775 CAGAGGCAGTTTCAGCTGATGGG + Intergenic
1022804424 7:33807502-33807524 TAGGGTCATTTCCATGTGATCGG + Intergenic
1025070022 7:55889796-55889818 TGGTGTCATTTTCAACTGATTGG + Intronic
1025625423 7:63216945-63216967 AAGGGTAATATTCAGCTGATAGG + Intergenic
1026189333 7:68110431-68110453 AGGGGTGATATTCAGCTGATAGG + Intergenic
1032193017 7:129775169-129775191 GAAGGTCATCTTGGGCTGATGGG - Intergenic
1033624253 7:143092876-143092898 GAGAGTCATTGGTAGCTGATGGG - Intergenic
1033853318 7:145525063-145525085 GAGTGTGATTTTCAGCAGAAAGG - Intergenic
1034094174 7:148391295-148391317 GAAGGTGATTTTCACATGATTGG + Intronic
1040745972 8:50642985-50643007 GGGTGACATTTTCAGATGATTGG - Intronic
1040789595 8:51210728-51210750 GTGAGTCATTTTCACCTGCTGGG - Intergenic
1045232971 8:100323187-100323209 GAGTGTTATTTTAAGATGATGGG + Intronic
1047103992 8:121713116-121713138 GAGGATCACTTTCAACTGGTTGG - Intergenic
1050449545 9:5765718-5765740 CAGGAACATTTTCAGCTGACTGG - Exonic
1051189620 9:14497813-14497835 GAGGGTCTTTTTCTTTTGATTGG + Intergenic
1057900747 9:98946011-98946033 GAGGGCCATTTGCAACTGATGGG + Intronic
1187293074 X:17973865-17973887 GAGGGTCTGATTCAGCAGATGGG - Intergenic
1187697588 X:21937503-21937525 CAGGGTCATTCTCACCTGACAGG - Intergenic
1189385152 X:40531173-40531195 GAGGGTGATTTACAGCCGCTAGG - Intergenic
1195632297 X:107070232-107070254 GAGGCTCATTGTCAGAAGATGGG + Intronic
1197986369 X:132270146-132270168 AGGGGTCATTTTCAGCTGCCAGG - Intergenic