ID: 1076541041

View in Genome Browser
Species Human (GRCh38)
Location 10:131214998-131215020
Sequence AAACAGGGGCACTCAGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076541037_1076541041 -7 Left 1076541037 10:131214982-131215004 CCTCACTCACAGGCGGAAACAGG 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1076541041 10:131214998-131215020 AAACAGGGGCACTCAGAGCTAGG No data
1076541030_1076541041 23 Left 1076541030 10:131214952-131214974 CCATGGCCGTGTCGGGGGCCCTG 0: 1
1: 0
2: 2
3: 19
4: 199
Right 1076541041 10:131214998-131215020 AAACAGGGGCACTCAGAGCTAGG No data
1076541033_1076541041 4 Left 1076541033 10:131214971-131214993 CCTGTTTCTGCCCTCACTCACAG 0: 1
1: 0
2: 3
3: 30
4: 298
Right 1076541041 10:131214998-131215020 AAACAGGGGCACTCAGAGCTAGG No data
1076541036_1076541041 -6 Left 1076541036 10:131214981-131215003 CCCTCACTCACAGGCGGAAACAG 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1076541041 10:131214998-131215020 AAACAGGGGCACTCAGAGCTAGG No data
1076541031_1076541041 17 Left 1076541031 10:131214958-131214980 CCGTGTCGGGGGCCCTGTTTCTG 0: 1
1: 0
2: 1
3: 6
4: 130
Right 1076541041 10:131214998-131215020 AAACAGGGGCACTCAGAGCTAGG No data
1076541032_1076541041 5 Left 1076541032 10:131214970-131214992 CCCTGTTTCTGCCCTCACTCACA 0: 1
1: 0
2: 1
3: 26
4: 354
Right 1076541041 10:131214998-131215020 AAACAGGGGCACTCAGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076541041 Original CRISPR AAACAGGGGCACTCAGAGCT AGG Intronic
No off target data available for this crispr