ID: 1076541799

View in Genome Browser
Species Human (GRCh38)
Location 10:131219619-131219641
Sequence GTCTCCCGCCTCCCCAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076541791_1076541799 28 Left 1076541791 10:131219568-131219590 CCTGCGGGCTGCAGTGCAAGGAG 0: 1
1: 0
2: 1
3: 29
4: 240
Right 1076541799 10:131219619-131219641 GTCTCCCGCCTCCCCAGGGAAGG No data
1076541794_1076541799 -2 Left 1076541794 10:131219598-131219620 CCTCACTGATCCTTTGTCCATGT 0: 1
1: 0
2: 0
3: 15
4: 204
Right 1076541799 10:131219619-131219641 GTCTCCCGCCTCCCCAGGGAAGG No data
1076541793_1076541799 1 Left 1076541793 10:131219595-131219617 CCTCCTCACTGATCCTTTGTCCA 0: 1
1: 0
2: 2
3: 18
4: 246
Right 1076541799 10:131219619-131219641 GTCTCCCGCCTCCCCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076541799 Original CRISPR GTCTCCCGCCTCCCCAGGGA AGG Intronic
No off target data available for this crispr