ID: 1076541933

View in Genome Browser
Species Human (GRCh38)
Location 10:131220210-131220232
Sequence TCCAGGCTGTTGGGGGCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076541933_1076541947 13 Left 1076541933 10:131220210-131220232 CCTATTGCCCCCAACAGCCTGGA 0: 1
1: 0
2: 4
3: 17
4: 164
Right 1076541947 10:131220246-131220268 CCAGGTGCCGCAGATGCCGTAGG No data
1076541933_1076541952 27 Left 1076541933 10:131220210-131220232 CCTATTGCCCCCAACAGCCTGGA 0: 1
1: 0
2: 4
3: 17
4: 164
Right 1076541952 10:131220260-131220282 TGCCGTAGGTCAGGAGGGCTTGG No data
1076541933_1076541942 -5 Left 1076541933 10:131220210-131220232 CCTATTGCCCCCAACAGCCTGGA 0: 1
1: 0
2: 4
3: 17
4: 164
Right 1076541942 10:131220228-131220250 CTGGAAGGGGAGACCCACCCAGG No data
1076541933_1076541951 22 Left 1076541933 10:131220210-131220232 CCTATTGCCCCCAACAGCCTGGA 0: 1
1: 0
2: 4
3: 17
4: 164
Right 1076541951 10:131220255-131220277 GCAGATGCCGTAGGTCAGGAGGG No data
1076541933_1076541948 18 Left 1076541933 10:131220210-131220232 CCTATTGCCCCCAACAGCCTGGA 0: 1
1: 0
2: 4
3: 17
4: 164
Right 1076541948 10:131220251-131220273 TGCCGCAGATGCCGTAGGTCAGG No data
1076541933_1076541950 21 Left 1076541933 10:131220210-131220232 CCTATTGCCCCCAACAGCCTGGA 0: 1
1: 0
2: 4
3: 17
4: 164
Right 1076541950 10:131220254-131220276 CGCAGATGCCGTAGGTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076541933 Original CRISPR TCCAGGCTGTTGGGGGCAAT AGG (reversed) Intronic
900098165 1:948795-948817 GCCAGGCTGTGTGGGGCCATGGG - Intronic
900365745 1:2311299-2311321 CCCTGGGTGTTGGGGGCAGTGGG + Intergenic
901340546 1:8494920-8494942 TCTTGGCTGTTGGGTGCCATGGG - Intronic
904395240 1:30215987-30216009 TCCAGGTTGTTGGGGCCTCTGGG - Intergenic
906096293 1:43226431-43226453 TCCAGGCTGGTGGGCACATTAGG - Intronic
908933550 1:69345490-69345512 GCCAGGGTGTTGGGGGCTAGGGG + Intergenic
909337125 1:74488270-74488292 TCTAGGTTGGTGGGGGCAGTGGG - Intronic
909952853 1:81739804-81739826 TCCAGGCTGTTCCAGGCATTAGG + Intronic
911051207 1:93673027-93673049 TCCAGGCTGTTGCAGGCATGGGG - Intronic
912948190 1:114102156-114102178 TCAAGGCTGCTGAGGGAAATAGG - Intronic
918381350 1:183958909-183958931 TGGAGGCTGTTGGGGGTAAGAGG - Intronic
922605786 1:226889061-226889083 GCAAGGCTGGTGGGGGCAGTGGG + Intronic
924039569 1:239971155-239971177 TCCAGGCTGGTGGTTGCAGTGGG + Intergenic
1062823077 10:549256-549278 TCCTGGGTGTTGGAGGCAATTGG - Intronic
1063006813 10:1979569-1979591 TCCAGGCAGATGGGGGGAAGCGG + Intergenic
1063592823 10:7409239-7409261 TCCCGGGTATTGGGTGCAATCGG - Intronic
1064128978 10:12690785-12690807 GTCAGGCAGTTGGGGGCAGTTGG + Intronic
1071495980 10:86167968-86167990 TCAAGGCTGTGGGGGTCTATGGG - Intronic
1072045442 10:91650132-91650154 TCCAGGGGGTGGGGGGCAAGGGG + Intergenic
1073046904 10:100644737-100644759 TCCAGGGTCTGGGAGGCAATGGG + Intergenic
1074434352 10:113421216-113421238 TCCAGGCTGGAGGGAGCACTAGG - Intergenic
1076316905 10:129548690-129548712 TGCAGGGTGCTGGGGGCAGTGGG + Intronic
1076422597 10:130341739-130341761 TCCAGGTTGATGGGGGCCGTGGG + Intergenic
1076541933 10:131220210-131220232 TCCAGGCTGTTGGGGGCAATAGG - Intronic
1076830432 10:132991768-132991790 TCCAGGCACTGGGGGGCCATTGG - Intergenic
1081596524 11:44463199-44463221 TCCAGGCTGGAAGGGGCAGTGGG - Intergenic
1081596674 11:44464081-44464103 TCCAGGCTGGAAGGGGCAGTAGG - Intergenic
1083028461 11:59570579-59570601 TCCAGGCTCTTGGGCCGAATGGG + Intergenic
1084472810 11:69373083-69373105 TCCAGGCTGTTGTGGGGACCTGG + Intergenic
1086286965 11:85261952-85261974 TCCAGCCAGTTGGGGTGAATGGG + Intronic
1087036219 11:93758768-93758790 TCCAGGCTGTAGGTGCCAAGGGG - Intronic
1087294218 11:96350913-96350935 TACAGGCAGTTGGATGCAATTGG - Intergenic
1088352782 11:108909178-108909200 TCCAGGGAGGTGGGGGGAATAGG - Intronic
1088939538 11:114439550-114439572 TCCAGGCTGTTGCGGGGTGTAGG + Exonic
1089663698 11:120002900-120002922 TCAAGTCTGTTAGGGCCAATAGG - Intergenic
1089670328 11:120052422-120052444 TCCAGGATCATGGGGGGAATGGG - Intergenic
1093546193 12:20352043-20352065 TCCAGGCTGCTGAGGCCAAAGGG + Intergenic
1094405911 12:30116018-30116040 TGGAGGCTGTTGGGGATAATGGG - Intergenic
1095749723 12:45697059-45697081 CCCAGGCTGTTTGTGCCAATGGG + Intergenic
1099338369 12:81394650-81394672 GTCAGGGTGTTGGGGGCAAGGGG + Intronic
1100821507 12:98435930-98435952 TGCAGGCTGTTGGGAACCATGGG + Intergenic
1105413178 13:20188620-20188642 CCCAGGCTGTTAGGGGTTATTGG - Exonic
1106373834 13:29164221-29164243 TCCAGCCTGTTGCGGGCACAGGG - Intronic
1107565279 13:41596326-41596348 TGAATGCTCTTGGGGGCAATGGG + Intronic
1109426195 13:62168323-62168345 TCCAGGCTGTAGGTGCCAAGGGG - Intergenic
1111651344 13:91094317-91094339 TCAAGCCTGTTGGGAGAAATTGG - Intergenic
1114663803 14:24367225-24367247 TCCAGCCTGTTGGGGGCGGGGGG + Intronic
1118261389 14:64250591-64250613 TGCAGGCTTTTGGGAGCAAAGGG - Intronic
1120151909 14:81045546-81045568 TGGAGCCTGTTGGGGGCCATGGG - Intronic
1120942796 14:89965085-89965107 TACATGCTGGTGGGGGCAAATGG + Intronic
1121049173 14:90809054-90809076 ACCAGGCTGCTGATGGCAATTGG - Intronic
1121609745 14:95269716-95269738 TCCATGCTGTGGGGGCCAGTGGG - Intronic
1121659613 14:95625005-95625027 TCCAGGCTATTGGAGGTCATGGG + Intergenic
1123044382 14:105504146-105504168 GCCAGGCTGGAGGGGGCACTGGG + Intergenic
1123699358 15:22903120-22903142 CCCAGGCTGTTGGTGTCTATGGG + Intronic
1128622460 15:69161482-69161504 TCCAGTCTTTTGGGGGCGACGGG + Intronic
1129939429 15:79480806-79480828 TGCAGGCTGTTGGGAGTAAGAGG + Intergenic
1131859407 15:96636523-96636545 TCCAGGCTGCTTGGGCCAAAAGG - Intergenic
1132012249 15:98286335-98286357 TCCAGGCTGGTGGTGGCCAGGGG + Intergenic
1133057596 16:3154028-3154050 TCCAGGATGTTTGGGGAACTGGG - Intergenic
1139934174 16:70556100-70556122 TCCAGGGTTTTGGGGTGAATTGG + Intronic
1140976294 16:80062999-80063021 TCCTGGGTTTTGGGGGCCATGGG - Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1141772904 16:86101723-86101745 TCCTGGCTCCTGGGGGAAATGGG - Intergenic
1142196203 16:88740417-88740439 TCCATGCTGATGGGGGCATGGGG - Intronic
1143175157 17:4950991-4951013 TTCAGGCTGTAGTGGGCACTTGG + Intronic
1146477151 17:33172268-33172290 TTCAGGCTTCTGGGGGCAATGGG + Intronic
1147377751 17:40032995-40033017 GCCAGCCTGTTGGGGGCAGGAGG - Intronic
1151983473 17:77527906-77527928 TCCAGGCTGTTGTGGGGGCTGGG + Intergenic
1151997285 17:77618047-77618069 TCCAGGATGATGGGGGCCATAGG - Intergenic
1152783159 17:82235364-82235386 CCCAGGCTGGAGGGGGCAGTTGG - Exonic
1154346624 18:13548364-13548386 CCCAGGCTGTTGGTGCCAAGGGG + Intronic
1154357562 18:13633451-13633473 CCCAGGCTGTTGGTGTCAAGGGG + Intronic
1157107955 18:44792551-44792573 TCCAGGCGGTGGTGGGCAACAGG - Intronic
1160742670 19:694733-694755 TCCAGGCTGGTGGGGGAGCTGGG - Intronic
1161993578 19:7698927-7698949 CCCAGGCTGTCGGGGGCTCTGGG - Intronic
1163429677 19:17259761-17259783 CCCAGGCTCTTGGTGACAATTGG - Intronic
1163702091 19:18791096-18791118 TCCAGGCTGTTTGGGGCTCACGG - Intronic
1163845710 19:19637225-19637247 TCCAGGCTCTCGGGGGCCATAGG - Intronic
1164046478 19:21547039-21547061 GTCAGGGTGTGGGGGGCAATGGG - Intronic
1164783303 19:30910619-30910641 TCCAGGCTGCTGGGGACGAAGGG - Intergenic
1164984402 19:32637995-32638017 TCCAGGCTGTTTGTGCCAAGGGG - Intronic
1165126908 19:33604555-33604577 ACCAGGATGGTGGGGGCTATGGG + Intergenic
1167324410 19:48815071-48815093 TCCAGCCTGGTGGGGGCAATCGG - Exonic
1167701029 19:51045972-51045994 TCCAGGCTATTGAGGGCAGTGGG - Intergenic
1167864013 19:52309380-52309402 TTCAGCCTGTGTGGGGCAATAGG + Intronic
1168446551 19:56421727-56421749 TCCAGGCTATTTTAGGCAATGGG + Intronic
925121163 2:1419566-1419588 TCCAGGCTGTTGAGGGCCTGGGG - Intronic
925978953 2:9161631-9161653 TCCAGGCTGCTGAGGACAGTTGG + Intergenic
926738310 2:16090936-16090958 TTCAGGCATTTGGGGGAAATGGG + Intergenic
927033808 2:19150899-19150921 TCGAGGCTGTTCAGGGCAGTGGG + Intergenic
927209752 2:20631843-20631865 TTCAGGCTCTTGGGGGTACTGGG - Intronic
929712517 2:44279382-44279404 TCCAGGATGGTGTGGGCAAAGGG - Intronic
931860901 2:66353382-66353404 TGGAGGCTGCTGGGGGCAGTAGG + Intergenic
931903923 2:66821955-66821977 TCCAGTCTCTTGGGGGCAGAAGG + Intergenic
932892032 2:75605821-75605843 ACCAGGCTGTGGGTGGCAATGGG - Intergenic
933768888 2:85730346-85730368 GCCAGGCTGCTGGGGGCAAATGG - Intergenic
934769213 2:96897194-96897216 TCCAGGGAGTGGGGGGGAATAGG - Intronic
938101932 2:128503518-128503540 TGCAGGCTGTTGGGGACCACAGG - Intergenic
938180695 2:129179356-129179378 TCCAGGCTGTAGGTGCCAATGGG + Intergenic
939203084 2:139063289-139063311 TCCTGAGTGATGGGGGCAATAGG - Intergenic
942743552 2:179206672-179206694 TCCAGGGAGTAGGGGGCAAATGG + Intronic
943220962 2:185105341-185105363 TCCAGGCTGCTGGGAGGAAGGGG - Intergenic
943553562 2:189372042-189372064 TTCAGGCTGTGCAGGGCAATGGG - Intergenic
946382085 2:219355606-219355628 TCCAGGCAGATGGGGCCAGTTGG + Intergenic
948496266 2:238351732-238351754 TCGAGGATGTTTGGGGCAATGGG + Intronic
1169525278 20:6417640-6417662 TCCTGGCTGGTGGGAGCAGTAGG - Intergenic
1170100686 20:12696122-12696144 TCAAGCCTGAAGGGGGCAATGGG + Intergenic
1170782392 20:19437628-19437650 TCCTGGCCGTTTGGGTCAATTGG - Intronic
1174168736 20:48603501-48603523 CCCAGGCTGTTGGGGGCAGGGGG - Intergenic
1176085446 20:63293643-63293665 TCCAGGGACTTGGGGGCACTCGG + Intronic
1177150989 21:17455341-17455363 TCCAGATTGTTTGGGGGAATTGG + Intergenic
1178244346 21:30936559-30936581 TCCAGGCTGCTGGAGCCAAGGGG - Intergenic
1180869429 22:19138026-19138048 TCCAGGCTGCTTGGGGCCGTGGG - Intronic
1180968192 22:19801363-19801385 GTCAGGCTGGTGGGGGCAAGGGG - Intronic
1181779233 22:25180940-25180962 TCCAGGCTGATGGGAGCCAGAGG - Intronic
1182934463 22:34207993-34208015 TCCAGGCTGTTGAAGACAACTGG - Intergenic
1184093983 22:42306577-42306599 TCCAGGCTGGTGGGAGAATTAGG + Intronic
1185272871 22:49936717-49936739 TTCAGGCTGGTGGGGGCAACAGG - Intergenic
950543159 3:13624353-13624375 TCCAGGCTGTGGGAGGCTCTTGG + Intronic
952262707 3:31755788-31755810 GCCATGCTGTTGAGGGCAAAAGG + Intronic
952416635 3:33096393-33096415 TCCAGGTTGAGGGGGGGAATAGG - Intronic
952878156 3:37965562-37965584 CCCAGGCTGGTGGGGGAAAGAGG - Intronic
955559437 3:60172780-60172802 TCCAGGCTGTTGCAGGAAAGAGG + Intronic
955925742 3:64003041-64003063 TCCAGGGGGTTTGGGGCGATTGG + Exonic
962309831 3:134317612-134317634 TCCAGGCAGATGGGGGCTTTAGG - Intergenic
962824583 3:139088676-139088698 TCCAGGCTGTAGGTGCCAAGGGG + Intronic
963522804 3:146377124-146377146 ACCAGGCAGTGGGAGGCAATTGG - Intergenic
965711458 3:171560007-171560029 TCCAGAATGTTGGGGGCAGGGGG - Intergenic
967221928 3:187254724-187254746 TGCAGGAGGTTGGGGGCAGTGGG + Intronic
968647735 4:1748811-1748833 TGCAGGCTGTTGGGGTCCAAAGG - Intergenic
969299685 4:6290644-6290666 CCCAGGCCGTTGGGGGTAAAGGG + Intronic
970750054 4:19348217-19348239 TCCAGGTTCTTCGGGGCTATCGG - Intergenic
976798635 4:88962543-88962565 TCCAGAGTGGTGGGAGCAATGGG + Intronic
981553740 4:145968572-145968594 CCCAGGCTGATGGGAGGAATTGG - Intergenic
983317058 4:166145842-166145864 TGAAGGCAGATGGGGGCAATGGG - Intergenic
983870890 4:172823964-172823986 CCCAAGCTGTTGGGGGCAATGGG + Intronic
983985973 4:174060915-174060937 TCAAGGCTGTTTAGGGCAGTGGG + Intergenic
984619213 4:181933010-181933032 CCCAGGGGGTTGGGGGCAAGGGG + Intergenic
984934037 4:184874289-184874311 TCCAGGCAGTTGGGGGACATTGG + Intergenic
985476082 5:80052-80074 TCCAGGCTGTGGTGGGTCATGGG - Intergenic
986444677 5:7811077-7811099 TCCAGGTTGTTGGGGGAAATGGG - Intronic
987084035 5:14452371-14452393 ACCAGGCTGCTGGGGGGAAAAGG - Intronic
987537677 5:19208930-19208952 TCCAGGCTGTTTGGGGGTAAGGG - Intergenic
988483240 5:31646878-31646900 TCCACGCTGATGGGGACACTCGG - Intronic
995736566 5:115307279-115307301 TGCAGGCAGTTGAGGGAAATAGG - Intergenic
997953093 5:138257675-138257697 TCCAGGCAGTTGGGGGCCACAGG + Exonic
999285894 5:150394053-150394075 TCCAGGCTGTCCAGGGCCATGGG - Intronic
1001058940 5:168471757-168471779 TCCAGCTTCATGGGGGCAATGGG + Intronic
1001588284 5:172848262-172848284 TCCAGGCTATTGGGGAAGATGGG + Intronic
1002066522 5:176654710-176654732 TCCAGGCTGGTGGAGGCAGAGGG - Intronic
1002847520 6:961417-961439 TCCAACCTGATGGGGGCAAGAGG - Intergenic
1008603594 6:53119076-53119098 TCCAGGCTGTTTGGACCCATTGG - Intergenic
1016783244 6:147983524-147983546 TCCATGCTTTTGGGAGCACTAGG - Intergenic
1017739362 6:157393278-157393300 TCCATGCTGTTGAGAGCCATGGG + Intronic
1020484955 7:8710314-8710336 TCCAGGCAGCTGGGGCAAATGGG + Intronic
1023104405 7:36749422-36749444 TCCAGGGGCTTGGGGGCAAAGGG + Intergenic
1027919816 7:84378554-84378576 TTCGGGGTGTTGGGGGCAAGGGG + Intronic
1029116599 7:98240974-98240996 TCCAGGCTGATGGGGGCCACTGG - Intronic
1030320331 7:108160505-108160527 TCAATGGTGTTGGTGGCAATAGG + Intronic
1034097292 7:148421638-148421660 TCCAGGGTGTGGGGGGCATGGGG - Intergenic
1034888757 7:154820472-154820494 TCCAGGCTTTTGGGGGCAACTGG - Intronic
1039420269 8:37431999-37432021 TCCAGGCTGGTGGTGGGCATGGG - Intergenic
1041274378 8:56142359-56142381 CCCAGGCTGTTCGGGCCAAGGGG - Intergenic
1044553825 8:93540699-93540721 TCCAGGCTTTTGAGGGCAGTTGG - Intergenic
1046254066 8:111673414-111673436 GTCAGGGTGTTGGGGGCAAGGGG - Intergenic
1048199753 8:132362497-132362519 TCAGGTCAGTTGGGGGCAATTGG + Intronic
1049316707 8:141973032-141973054 GCCAGGGTGTTCTGGGCAATGGG + Intergenic
1049392267 8:142378146-142378168 CCTGGGCTGTTTGGGGCAATCGG - Intronic
1050182245 9:2934074-2934096 CCCAGCCTGCTGGGGGCAAGCGG - Intergenic
1050483947 9:6114539-6114561 TCCAGGCTGTAGGTGCCAAGGGG - Intergenic
1052691415 9:31820868-31820890 CCCAGGCTGTTGGTGCCAAGGGG - Intergenic
1052707524 9:32011005-32011027 TCCAGGCTGTAGGTGACAAGGGG - Intergenic
1052836645 9:33255113-33255135 TCAGGGCTGCTGGGGGCAACTGG - Exonic
1053732650 9:41073956-41073978 TCAAGGCTTTTGGGGGCGGTGGG + Intergenic
1053853079 9:42309454-42309476 ACTGGGATGTTGGGGGCAATGGG + Intergenic
1054695780 9:68357598-68357620 TCAAGGCTTTTGGGGGCGGTGGG - Intronic
1058510725 9:105713597-105713619 TCCAGGCTGTTGGCACCAAGGGG - Intronic
1059694360 9:116716656-116716678 TCCAGGCAGTTGATTGCAATGGG + Intronic
1060215407 9:121735906-121735928 CCCAGGCTTCTGGGCGCAATCGG + Intronic
1060974780 9:127758467-127758489 ACCAGGCAGCTGGGGTCAATGGG + Intronic
1186044982 X:5525940-5525962 ACCAGGCTTCTGGGGGCAATAGG + Intergenic
1186644021 X:11486948-11486970 TGGAGGCTGGTGGTGGCAATGGG + Intronic
1187967312 X:24624788-24624810 CCCAGGCTGGTAGGGGCAAGGGG - Intronic
1195220180 X:102738956-102738978 TCCAGAATGGTGGGGGCAACTGG + Intronic
1199940476 X:152621396-152621418 TCCAGGCTGTTATGGGGCATGGG + Intergenic