ID: 1076544400

View in Genome Browser
Species Human (GRCh38)
Location 10:131235083-131235105
Sequence GGGCCCAGGGTACCACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076544393_1076544400 12 Left 1076544393 10:131235048-131235070 CCTCTGGACAGTGGGAGAGTTCA 0: 1
1: 1
2: 1
3: 6
4: 185
Right 1076544400 10:131235083-131235105 GGGCCCAGGGTACCACAGGCAGG No data
1076544389_1076544400 29 Left 1076544389 10:131235031-131235053 CCACATGAGGTGGTGAGCCTCTG 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1076544400 10:131235083-131235105 GGGCCCAGGGTACCACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076544400 Original CRISPR GGGCCCAGGGTACCACAGGC AGG Intronic
No off target data available for this crispr