ID: 1076544886

View in Genome Browser
Species Human (GRCh38)
Location 10:131238579-131238601
Sequence CATGGAGGAAGGTTCCCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076544886_1076544891 13 Left 1076544886 10:131238579-131238601 CCTATTGGGAACCTTCCTCCATG 0: 1
1: 0
2: 0
3: 14
4: 94
Right 1076544891 10:131238615-131238637 GTGCTTGTTCAAGCTTGCTGCGG No data
1076544886_1076544892 29 Left 1076544886 10:131238579-131238601 CCTATTGGGAACCTTCCTCCATG 0: 1
1: 0
2: 0
3: 14
4: 94
Right 1076544892 10:131238631-131238653 GCTGCGGTTCTTTGTGAAATAGG No data
1076544886_1076544888 -9 Left 1076544886 10:131238579-131238601 CCTATTGGGAACCTTCCTCCATG 0: 1
1: 0
2: 0
3: 14
4: 94
Right 1076544888 10:131238593-131238615 TCCTCCATGTTCATTATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076544886 Original CRISPR CATGGAGGAAGGTTCCCAAT AGG (reversed) Intronic
902361587 1:15945092-15945114 CAAGGAGGAGGGTTCCCAGCTGG - Exonic
904179319 1:28654785-28654807 CAGGGATGAAGGTTACTAATGGG - Intergenic
910519038 1:88096930-88096952 CAGGGAGGATGAGTCCCAATAGG - Intergenic
913970151 1:143408774-143408796 CAGGGAGGAATGGTCCCAAAAGG - Intergenic
914064526 1:144234371-144234393 CAGGGAGGAATGGTCCCAAAAGG - Intergenic
914114624 1:144731983-144732005 CAGGGAGGAATGGTCCCAAAAGG + Intergenic
917930688 1:179820676-179820698 CAGGAAGGAAGGTTCCCTCTGGG + Intergenic
917931101 1:179823436-179823458 CAGGAAGGAAGGTTCCCTCTGGG + Intergenic
919784023 1:201246846-201246868 CATGGATTAAGTTTCCAAATAGG - Intergenic
1062795011 10:338636-338658 CATGGGGGTACGTTCCAAATGGG - Intronic
1063808324 10:9674046-9674068 CATGGAGCAAGGATGCCACTGGG - Intergenic
1068966089 10:62913304-62913326 CATTGAGCAAGATTCACAATAGG - Intronic
1072091883 10:92136966-92136988 CATGGAGGAGGGATTCCAAGAGG - Intronic
1072983483 10:100119111-100119133 CATGGAGGGATGTACCCAGTGGG + Intergenic
1074274836 10:111991306-111991328 GAAGGAGGAAGCTTCCCAAATGG + Intergenic
1076544886 10:131238579-131238601 CATGGAGGAAGGTTCCCAATAGG - Intronic
1081435256 11:43020839-43020861 CATTGAGGTAGGTTCCAAATAGG + Intergenic
1082932058 11:58618393-58618415 CTTGGAAGCAGGCTCCCAATAGG + Exonic
1083108559 11:60382586-60382608 CAAGGAGGAAGATTCCGGATGGG + Intronic
1086052386 11:82608798-82608820 TATGGAAGAAGCTTCCCAAAGGG + Intergenic
1089831155 11:121329336-121329358 CATGGAGCAAGGTCCCAAAGGGG - Intergenic
1091723995 12:2833246-2833268 CATGTAGGATGGTCCCCAGTAGG + Intronic
1094188857 12:27676452-27676474 CTGGGAGGAAGGGTCCCAAATGG - Exonic
1097071275 12:56356587-56356609 GAAGGATGAGGGTTCCCAATTGG + Intronic
1103648373 12:122413689-122413711 CACCAAGGAGGGTTCCCAATAGG + Intronic
1106555205 13:30803332-30803354 CATGGCGCAAGGTTCCAAGTAGG - Intergenic
1107263613 13:38524943-38524965 CATGGAGAAAGGGGCCCACTAGG + Intergenic
1107781195 13:43904147-43904169 CATGGAGGAATGGTCTCAAAGGG + Intergenic
1115445714 14:33486920-33486942 CAAGCATGAAGGCTCCCAATAGG - Intronic
1116020574 14:39455261-39455283 CATGGAAAAAGGTTGCCAAGTGG - Intergenic
1122517426 14:102318844-102318866 CAAGGAGGAAACTTCCCAAGGGG - Intronic
1122718348 14:103708277-103708299 CATGGAGCAAGGTCCCCAGGAGG + Intronic
1123116147 14:105894928-105894950 CCTGGAAGAAGGTGCCCACTGGG + Intergenic
1124645445 15:31434863-31434885 CATGCAGGAAGGCGCCCAGTGGG - Intronic
1125307684 15:38339715-38339737 CATTGAGGGTTGTTCCCAATAGG + Exonic
1125508584 15:40281316-40281338 CAGGGAGGCAGGTTCCAAAATGG + Intronic
1125736093 15:41926891-41926913 CCTGGAGGAAAGTTCCCCAGAGG - Intronic
1127688076 15:61368004-61368026 CATGGAGGAAGGTTATGCATGGG + Intergenic
1130162017 15:81411196-81411218 CAGGGAGGAAGGTTCCCTTTAGG - Intergenic
1134776068 16:16854763-16854785 CATAGAGAAAGGTGCCCCATAGG - Intergenic
1135480974 16:22820262-22820284 CATGGAGGAACATTCGGAATGGG + Intronic
1139655838 16:68386894-68386916 CAAGGAGGAGGGTTGCCAAGAGG + Intronic
1141577205 16:84971631-84971653 CATGGAGGAGGGCTTCTAATAGG + Intergenic
1141798637 16:86291932-86291954 CATATAGGAAGGTTCCCCAGGGG + Intergenic
1142678521 17:1531188-1531210 CACTGAGGAAGGGTCCCAGTGGG - Intronic
1146499389 17:33351522-33351544 CATGGAGAAAAGTGCCCAGTGGG - Intronic
1146605765 17:34256440-34256462 AATGTACAAAGGTTCCCAATGGG + Intronic
1150322743 17:64230222-64230244 CATGGTGGAAGGTTTCCCAGGGG + Intronic
1152212225 17:79008872-79008894 CCTGGAGGAAGGCTCCAAATTGG + Intronic
1153234037 18:2968666-2968688 AAGGAAGGAAGGTTCCCAGTGGG + Intronic
1160456394 18:79005426-79005448 CATGGAGGAAGTTGCCCCACTGG - Intergenic
1163330901 19:16637025-16637047 CATGGAGGAAAGTTCTAATTGGG - Intronic
1164838264 19:31372841-31372863 CATGGGGGAGTGTTCCCAATAGG - Intergenic
925601941 2:5617068-5617090 CATGGAAGAAGGTTCCGAAGAGG + Intergenic
925966033 2:9066961-9066983 CATGCAGGATGGTACCCAAGAGG - Intergenic
929565138 2:42979211-42979233 CAAGGAGGAAGGTCCACAAAGGG + Intergenic
933127781 2:78632627-78632649 CATGCAGGAATGTTCTGAATTGG - Intergenic
934174845 2:89569684-89569706 CAGGGAGGAATGGTCCCAAAAGG - Intergenic
934285162 2:91644036-91644058 CAGGGAGGAATGGTCCCAAAAGG - Intergenic
935315587 2:101830619-101830641 TATGGAGGAATCTGCCCAATTGG + Intronic
936075230 2:109397558-109397580 CCTGGAGGAAGTTTCCCACTTGG - Intronic
937979873 2:127608675-127608697 CGTGGAGGAAGGTTACCCAGGGG - Intronic
938435876 2:131283314-131283336 CATAGTGGAAGTTTCCCAAGAGG + Intronic
941951975 2:171165129-171165151 CATGGAGGAATATTCCCAGAGGG + Intronic
1172786899 20:37474489-37474511 CAAGGAGGAGGGTTTCCAAAAGG - Intergenic
1173433960 20:43016167-43016189 TATGGAGCAAGGTCCCCACTGGG + Intronic
1173960991 20:47072347-47072369 CTAAGAGGCAGGTTCCCAATGGG - Intronic
1175923609 20:62461556-62461578 CATGAAGGGAGGTCCCCAAAGGG - Intergenic
1178627262 21:34228405-34228427 CATGGTGGAAGGTTCATACTTGG + Intergenic
1181745379 22:24952449-24952471 CCCGGAGCAAAGTTCCCAATTGG + Intergenic
1183626157 22:39003518-39003540 CCTTGAGGAAGGTCCCCAGTAGG + Intergenic
949184769 3:1177094-1177116 CATGGAGAAGGGTTCCCAGTTGG - Intronic
949617879 3:5775090-5775112 GATGGAGGAAGGATACCATTAGG - Intergenic
959166328 3:102783416-102783438 CATGAAGGAATGTTGCCAATTGG - Intergenic
970515071 4:16821134-16821156 CACGGAAGAAGGTGCCAAATGGG - Intronic
972668160 4:41188267-41188289 CATGGAGGTAGCTTGTCAATAGG - Intronic
980203821 4:129691794-129691816 CATGGAGGCAGTTTCCCACATGG - Intergenic
980648361 4:135675689-135675711 GATGGAAGCAGTTTCCCAATTGG + Intergenic
982276689 4:153642845-153642867 CATGAAGGAAGCTTCCAAATGGG - Intergenic
983230420 4:165124547-165124569 CTTGGAGAAAGGTTACCATTAGG - Intronic
991937345 5:71815272-71815294 GATGGAGGAAGGATCACAAAAGG + Intergenic
994731690 5:103499193-103499215 CATTGAGGGAGGGTCCCAAATGG + Intergenic
998205346 5:140153495-140153517 CAGGGAGGAAGGTTCCCCAGCGG + Intergenic
1002834967 6:858103-858125 CTTGGAGGAAAGTTTCCCATTGG - Intergenic
1003620096 6:7691959-7691981 CATGGAGGCATTTCCCCAATAGG - Intergenic
1004180316 6:13375712-13375734 CATGGGGGACGGTTCACAAAGGG - Intronic
1007584598 6:42981430-42981452 CATGGATGAAAGTTCCCATTTGG + Intergenic
1009028598 6:58029921-58029943 CATGGAGGAAGGCTTCCCTTTGG + Intergenic
1009044626 6:58223470-58223492 AATGGAGGAAGGGTGTCAATGGG + Intergenic
1009204129 6:60781308-60781330 CATGGAGGAAGGCTTCCCTTTGG + Intergenic
1013675626 6:112458470-112458492 CATGGAGGGAGGGTCCCAACTGG - Intergenic
1014881039 6:126724975-126724997 CAGGAAGGAAGTTTCCCAATGGG - Intergenic
1015497083 6:133893234-133893256 CATGGAGGAAGGATCCCGCTAGG + Exonic
1018229038 6:161657888-161657910 CATGGTGGCAGGTGCCCACTCGG + Intronic
1022043303 7:26601697-26601719 CAGGGAGGCTGCTTCCCAATCGG + Intergenic
1024575048 7:50756450-50756472 CATGGAGGCAGGTTCCTGCTGGG - Intronic
1037344825 8:17887315-17887337 CATGAAGGAGGCTTCCCAACTGG - Intronic
1037604655 8:20427334-20427356 CATGGAGGAAGGTATCTCATGGG - Intergenic
1043973926 8:86564082-86564104 GAGGGAGCAAGGTTCCCAAGTGG - Intronic
1045459922 8:102416553-102416575 CAGAGAGGCAGTTTCCCAATAGG - Intergenic
1047458109 8:125034775-125034797 CATGGAGGAAGAATCCTAACAGG + Intronic
1052290336 9:26833132-26833154 TATGGATGAAGGTTCTTAATTGG - Intergenic
1053495718 9:38546752-38546774 CATGGTAGAAGTTTCCCAAGAGG - Intronic
1056585829 9:87926564-87926586 CATAGTGGAAGTTTCCCAAGAGG - Intergenic
1056611053 9:88126379-88126401 CATAGTGGAAGTTTCCCAAGAGG + Intergenic
1057599815 9:96448661-96448683 CAAGTAGGGAGGTTCCCAAGTGG + Intergenic
1057675650 9:97134267-97134289 CATAGTGGAAGTTTCCCAAGAGG - Intergenic
1058249178 9:102669593-102669615 CATGGAGGAAGCATCCGAACTGG - Intergenic
1195141916 X:101969714-101969736 CATGGAAGAAGGATGCAAATAGG + Intergenic